Incidental Mutation 'R0004:Sf1'
ID32426
Institutional Source Beutler Lab
Gene Symbol Sf1
Ensembl Gene ENSMUSG00000024949
Gene Namesplicing factor 1
SynonymsMZFM, Zfp162, CW17R, WBP4
MMRRC Submission 038300-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0004 (G1)
Quality Score205
Status Validated (trace)
Chromosome19
Chromosomal Location6363690-6378030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6374191 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 417 (P417Q)
Ref Sequence ENSEMBL: ENSMUSP00000121309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113485] [ENSMUST00000113487] [ENSMUST00000113488] [ENSMUST00000113489] [ENSMUST00000124667] [ENSMUST00000131252] [ENSMUST00000144409] [ENSMUST00000155973]
Predicted Effect probably benign
Transcript: ENSMUST00000113485
SMART Domains Protein: ENSMUSP00000109113
Gene: ENSMUSG00000024949

DomainStartEndE-ValueType
PDB:2M0G|A 1 86 3e-33 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000113487
AA Change: P417Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109115
Gene: ENSMUSG00000024949
AA Change: P417Q

DomainStartEndE-ValueType
KH 134 227 4.38e-13 SMART
ZnF_C2HC 278 294 4.45e-3 SMART
low complexity region 335 358 N/A INTRINSIC
low complexity region 378 402 N/A INTRINSIC
low complexity region 406 446 N/A INTRINSIC
low complexity region 468 524 N/A INTRINSIC
low complexity region 532 540 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113488
AA Change: P417Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109116
Gene: ENSMUSG00000024949
AA Change: P417Q

DomainStartEndE-ValueType
KH 134 227 4.38e-13 SMART
ZnF_C2HC 278 294 4.45e-3 SMART
low complexity region 335 358 N/A INTRINSIC
low complexity region 378 402 N/A INTRINSIC
low complexity region 406 446 N/A INTRINSIC
low complexity region 468 524 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
low complexity region 567 599 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113489
AA Change: P417Q
SMART Domains Protein: ENSMUSP00000109117
Gene: ENSMUSG00000024949
AA Change: P417Q

DomainStartEndE-ValueType
KH 134 227 4.38e-13 SMART
ZnF_C2HC 278 294 4.45e-3 SMART
low complexity region 335 358 N/A INTRINSIC
low complexity region 378 402 N/A INTRINSIC
low complexity region 406 448 N/A INTRINSIC
low complexity region 472 517 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124667
AA Change: P61Q
SMART Domains Protein: ENSMUSP00000114788
Gene: ENSMUSG00000024949
AA Change: P61Q

DomainStartEndE-ValueType
low complexity region 22 46 N/A INTRINSIC
low complexity region 50 90 N/A INTRINSIC
low complexity region 120 176 N/A INTRINSIC
low complexity region 184 192 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000125516
AA Change: P105Q
SMART Domains Protein: ENSMUSP00000117172
Gene: ENSMUSG00000024949
AA Change: P105Q

DomainStartEndE-ValueType
low complexity region 24 47 N/A INTRINSIC
low complexity region 67 91 N/A INTRINSIC
low complexity region 95 135 N/A INTRINSIC
low complexity region 157 171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131252
AA Change: P417Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121309
Gene: ENSMUSG00000024949
AA Change: P417Q

DomainStartEndE-ValueType
Pfam:SF1-HH 18 130 1.5e-47 PFAM
KH 134 227 4.38e-13 SMART
ZnF_C2HC 278 294 4.45e-3 SMART
low complexity region 335 358 N/A INTRINSIC
low complexity region 378 402 N/A INTRINSIC
low complexity region 406 446 N/A INTRINSIC
low complexity region 468 524 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
low complexity region 564 609 N/A INTRINSIC
low complexity region 615 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144239
Predicted Effect probably benign
Transcript: ENSMUST00000144409
SMART Domains Protein: ENSMUSP00000123175
Gene: ENSMUSG00000024949

DomainStartEndE-ValueType
PDB:2M09|A 1 27 4e-12 PDB
Predicted Effect unknown
Transcript: ENSMUST00000162237
AA Change: P21Q
SMART Domains Protein: ENSMUSP00000124590
Gene: ENSMUSG00000024949
AA Change: P21Q

DomainStartEndE-ValueType
low complexity region 11 55 N/A INTRINSIC
low complexity region 74 119 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154260
Predicted Effect probably benign
Transcript: ENSMUST00000155973
SMART Domains Protein: ENSMUSP00000114438
Gene: ENSMUSG00000024949

DomainStartEndE-ValueType
PDB:4FXW|D 1 106 9e-71 PDB
KH 108 201 4.38e-13 SMART
ZnF_C2HC 252 267 1.43e-1 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Mice heterozygous for a gene trapped allele exhibit embryonic lethalilty prior to E8.5. Mice heterozygous for a gene trapped allele exhibit increased incidence of chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T C 2: 121,152,485 I86T probably damaging Het
Aff3 T C 1: 38,269,726 D376G possibly damaging Het
Akap11 A T 14: 78,514,940 H164Q possibly damaging Het
Akap12 A T 10: 4,353,220 D10V probably damaging Het
Arhgap32 T C 9: 32,151,998 V101A probably damaging Het
Atm A T 9: 53,453,528 probably benign Het
Ccdc18 A G 5: 108,161,700 D387G possibly damaging Het
Ccdc38 A T 10: 93,574,102 Q261L probably damaging Het
Cd180 T G 13: 102,702,708 V33G probably benign Het
Cd207 G A 6: 83,674,248 Q242* probably null Het
Cnp T C 11: 100,576,807 F192S probably damaging Het
Colec10 G T 15: 54,410,875 R33L possibly damaging Het
Csn1s1 A T 5: 87,671,531 M16L probably benign Het
Dnah10 A T 5: 124,726,902 M98L probably benign Het
Dnah17 T C 11: 118,060,092 I2902V possibly damaging Het
Dtnb A G 12: 3,596,635 probably benign Het
Epha5 T C 5: 84,331,842 Y101C probably damaging Het
Ephb2 T A 4: 136,657,524 M860L probably damaging Het
Fbxw18 T C 9: 109,701,313 T77A probably damaging Het
Fgfbp3 A G 19: 36,918,682 S179P possibly damaging Het
Foxp2 A G 6: 15,197,096 T45A possibly damaging Het
Gckr A T 5: 31,297,589 probably benign Het
Glce T A 9: 62,068,579 Q213L probably damaging Het
Gm1965 A C 6: 89,146,487 H84P unknown Het
Hbegf A G 18: 36,507,506 V166A probably damaging Het
Helb G T 10: 120,108,981 H217N probably damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kansl2 A G 15: 98,520,376 L392P probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Klra3 A G 6: 130,323,687 S240P probably damaging Het
Liph T A 16: 21,984,194 R42* probably null Het
Lrp1 A T 10: 127,541,825 probably null Het
Luc7l2 A T 6: 38,589,234 K52M probably damaging Het
Mecom G A 3: 29,979,911 P215S probably damaging Het
Myo1g T A 11: 6,515,901 T395S probably damaging Het
Ndst4 T A 3: 125,570,826 M384K probably benign Het
Ndufb2 C T 6: 39,596,504 T51I possibly damaging Het
Nell1 C A 7: 50,560,759 probably benign Het
Olfr639 A T 7: 104,012,431 N90K probably benign Het
Oxr1 G A 15: 41,820,540 S434N possibly damaging Het
Pcdhac2 T A 18: 37,145,237 S423R probably benign Het
Pcdhb10 T A 18: 37,411,959 D29E probably benign Het
Pde10a A G 17: 8,981,576 T1053A probably benign Het
Pkdrej T A 15: 85,818,183 H1184L probably damaging Het
Prkaa2 C T 4: 105,047,091 R263Q probably null Het
Prmt9 A G 8: 77,555,782 I103V possibly damaging Het
Rbm15b T C 9: 106,884,936 T678A probably benign Het
Ryr2 T C 13: 11,665,919 Y3180C probably benign Het
Scaf1 T C 7: 45,007,670 probably benign Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec23b T C 2: 144,564,562 probably benign Het
Slc4a3 A T 1: 75,557,009 probably benign Het
Stk32a T C 18: 43,305,056 W207R probably damaging Het
Syne1 A T 10: 5,443,132 probably benign Het
Tecta A T 9: 42,345,478 V1634E possibly damaging Het
Tenm2 A G 11: 36,023,357 F2450S probably damaging Het
Tgfb1 T C 7: 25,692,366 probably benign Het
Tpgs2 A G 18: 25,158,238 probably benign Het
Washc5 A G 15: 59,367,467 M149T probably damaging Het
Wrn A T 8: 33,317,560 V290D probably damaging Het
Zbtb41 A G 1: 139,442,888 T688A possibly damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp791 G A 8: 85,110,866 A123V probably benign Het
Other mutations in Sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Sf1 APN 19 6372022 unclassified probably benign
IGL01713:Sf1 APN 19 6374289 critical splice donor site probably null
R1638:Sf1 UTSW 19 6372060 missense possibly damaging 0.62
R2999:Sf1 UTSW 19 6374876 unclassified probably benign
R4088:Sf1 UTSW 19 6368440 critical splice donor site probably null
R4254:Sf1 UTSW 19 6371647 missense probably damaging 1.00
R4559:Sf1 UTSW 19 6374815 small deletion probably benign
R4575:Sf1 UTSW 19 6375913 unclassified probably benign
R4736:Sf1 UTSW 19 6365664 missense probably damaging 0.99
R4794:Sf1 UTSW 19 6375664 unclassified probably benign
R5050:Sf1 UTSW 19 6372559 missense probably damaging 1.00
R6678:Sf1 UTSW 19 6374513 splice site probably null
R6834:Sf1 UTSW 19 6374097 missense probably damaging 1.00
R7248:Sf1 UTSW 19 6376353 missense unknown
R7574:Sf1 UTSW 19 6372204 missense probably damaging 0.96
R8100:Sf1 UTSW 19 6372338 missense possibly damaging 0.70
R8301:Sf1 UTSW 19 6368366 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATGTCTACAACTCAGAGCCGCC -3'
(R):5'- TCCATGAGCCTAGACCTCAGCAAG -3'

Sequencing Primer
(F):5'- CCACCCTGGATGAATTCTGGTC -3'
(R):5'- TCAGCAAGATTCAGAGTACTAGC -3'
Posted On2013-05-09