Incidental Mutation 'R4344:Vmn2r22'
ID324263
Institutional Source Beutler Lab
Gene Symbol Vmn2r22
Ensembl Gene ENSMUSG00000095486
Gene Namevomeronasal 2, receptor 22
SynonymsEG546913
MMRRC Submission 041101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4344 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123609758-123650635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 123637797 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 278 (G278D)
Ref Sequence ENSEMBL: ENSMUSP00000132043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170808]
Predicted Effect probably damaging
Transcript: ENSMUST00000170808
AA Change: G278D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132043
Gene: ENSMUSG00000095486
AA Change: G278D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 473 1.4e-32 PFAM
Pfam:NCD3G 517 570 2.2e-23 PFAM
Pfam:7tm_3 601 838 1.2e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,826,748 R5S possibly damaging Het
Ccdc187 T A 2: 26,280,669 K599I probably damaging Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cep19 C T 16: 32,107,065 T97M probably damaging Het
Ces2a T G 8: 104,737,134 D159E probably damaging Het
Dcc G A 18: 71,374,490 A917V probably damaging Het
Dennd6b G A 15: 89,188,663 A196V probably benign Het
Dlgap3 T C 4: 127,214,348 S475P possibly damaging Het
Doc2a C T 7: 126,851,149 P156S probably damaging Het
Elmo1 T A 13: 20,261,552 probably null Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8251 G A 1: 44,060,991 L316F possibly damaging Het
Klk1b8 C A 7: 43,945,762 probably benign Het
Lmcd1 T A 6: 112,288,007 probably benign Het
Lyst T A 13: 13,698,466 I2750K probably benign Het
Muc4 A G 16: 32,770,292 N2958S possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp1r16b G A 2: 158,749,186 V163I probably damaging Het
Prkdc T A 16: 15,768,022 W2475R probably damaging Het
Rad54l C T 4: 116,097,354 C684Y probably damaging Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rasef T A 4: 73,745,089 H167L probably damaging Het
Sh3bp2 T C 5: 34,555,542 F165L possibly damaging Het
Slc38a9 T C 13: 112,729,215 I482T probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttc39c T A 18: 12,728,610 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Yme1l1 G A 2: 23,173,061 A215T probably benign Het
Zmynd15 C T 11: 70,461,068 R38* probably null Het
Other mutations in Vmn2r22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r22 APN 6 123638053 missense probably damaging 1.00
IGL01764:Vmn2r22 APN 6 123650420 critical splice donor site probably null
IGL02037:Vmn2r22 APN 6 123649067 missense probably damaging 1.00
IGL02183:Vmn2r22 APN 6 123638004 missense probably damaging 1.00
IGL02335:Vmn2r22 APN 6 123638092 missense probably damaging 0.99
IGL02440:Vmn2r22 APN 6 123637405 missense probably benign 0.00
IGL02663:Vmn2r22 APN 6 123649158 missense probably benign 0.11
IGL03101:Vmn2r22 APN 6 123637336 missense probably benign 0.09
R0266:Vmn2r22 UTSW 6 123637404 missense probably damaging 0.99
R0348:Vmn2r22 UTSW 6 123637725 missense probably damaging 1.00
R0780:Vmn2r22 UTSW 6 123637974 missense probably damaging 1.00
R0849:Vmn2r22 UTSW 6 123637404 missense probably damaging 0.99
R1074:Vmn2r22 UTSW 6 123649258 missense probably benign 0.02
R1456:Vmn2r22 UTSW 6 123637665 missense possibly damaging 0.86
R1719:Vmn2r22 UTSW 6 123637843 missense possibly damaging 0.68
R1989:Vmn2r22 UTSW 6 123637541 missense probably damaging 1.00
R2928:Vmn2r22 UTSW 6 123637443 missense probably damaging 0.96
R2939:Vmn2r22 UTSW 6 123637635 missense probably damaging 0.99
R3727:Vmn2r22 UTSW 6 123650625 missense possibly damaging 0.70
R3782:Vmn2r22 UTSW 6 123650632 nonsense probably null
R3873:Vmn2r22 UTSW 6 123637380 missense possibly damaging 0.68
R4407:Vmn2r22 UTSW 6 123637954 missense probably damaging 1.00
R4428:Vmn2r22 UTSW 6 123637858 missense possibly damaging 0.47
R4430:Vmn2r22 UTSW 6 123637858 missense possibly damaging 0.47
R4431:Vmn2r22 UTSW 6 123637858 missense possibly damaging 0.47
R4701:Vmn2r22 UTSW 6 123650469 missense probably benign 0.00
R5274:Vmn2r22 UTSW 6 123650634 start codon destroyed probably null 0.93
R5668:Vmn2r22 UTSW 6 123637914 missense probably benign 0.06
R5776:Vmn2r22 UTSW 6 123637714 missense probably damaging 1.00
R6416:Vmn2r22 UTSW 6 123637738 missense probably damaging 1.00
R7788:Vmn2r22 UTSW 6 123637600 missense not run
Predicted Primers PCR Primer
(F):5'- TCCCAGAATTTGATCCATGCGATC -3'
(R):5'- TCAGGGAATTATTCAACTGCTGC -3'

Sequencing Primer
(F):5'- CAGAAAATGATAATCCTCCACCAAAG -3'
(R):5'- GGCCTAGTAGTCCCAGATGATATTC -3'
Posted On2015-06-24