Incidental Mutation 'R4344:Slc38a9'
ID324271
Institutional Source Beutler Lab
Gene Symbol Slc38a9
Ensembl Gene ENSMUSG00000047789
Gene Namesolute carrier family 38, member 9
Synonyms
MMRRC Submission 041101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R4344 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location112660751-112738749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112729215 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 482 (I482T)
Ref Sequence ENSEMBL: ENSMUSP00000052172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052514]
Predicted Effect probably benign
Transcript: ENSMUST00000052514
AA Change: I482T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000052172
Gene: ENSMUSG00000047789
AA Change: I482T

DomainStartEndE-ValueType
Pfam:Aa_trans 114 253 4.5e-17 PFAM
Pfam:Aa_trans 266 560 2.5e-16 PFAM
Meta Mutation Damage Score 0.0986 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,826,748 R5S possibly damaging Het
Ccdc187 T A 2: 26,280,669 K599I probably damaging Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cep19 C T 16: 32,107,065 T97M probably damaging Het
Ces2a T G 8: 104,737,134 D159E probably damaging Het
Dcc G A 18: 71,374,490 A917V probably damaging Het
Dennd6b G A 15: 89,188,663 A196V probably benign Het
Dlgap3 T C 4: 127,214,348 S475P possibly damaging Het
Doc2a C T 7: 126,851,149 P156S probably damaging Het
Elmo1 T A 13: 20,261,552 probably null Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8251 G A 1: 44,060,991 L316F possibly damaging Het
Klk1b8 C A 7: 43,945,762 probably benign Het
Lmcd1 T A 6: 112,288,007 probably benign Het
Lyst T A 13: 13,698,466 I2750K probably benign Het
Muc4 A G 16: 32,770,292 N2958S possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp1r16b G A 2: 158,749,186 V163I probably damaging Het
Prkdc T A 16: 15,768,022 W2475R probably damaging Het
Rad54l C T 4: 116,097,354 C684Y probably damaging Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rasef T A 4: 73,745,089 H167L probably damaging Het
Sh3bp2 T C 5: 34,555,542 F165L possibly damaging Het
Tmprss6 T A 15: 78,459,427 probably null Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttc39c T A 18: 12,728,610 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn2r22 C T 6: 123,637,797 G278D probably damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Yme1l1 G A 2: 23,173,061 A215T probably benign Het
Zmynd15 C T 11: 70,461,068 R38* probably null Het
Other mutations in Slc38a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Slc38a9 APN 13 112701618 missense probably damaging 1.00
IGL01950:Slc38a9 APN 13 112695253 missense probably damaging 1.00
IGL01955:Slc38a9 APN 13 112695418 splice site probably benign
IGL02352:Slc38a9 APN 13 112690186 missense probably benign 0.10
IGL02359:Slc38a9 APN 13 112690186 missense probably benign 0.10
IGL02407:Slc38a9 APN 13 112690243 missense probably benign
IGL02511:Slc38a9 APN 13 112698007 missense possibly damaging 0.47
IGL02588:Slc38a9 APN 13 112697977 splice site probably null
IGL03278:Slc38a9 APN 13 112689518 splice site probably benign
R0126:Slc38a9 UTSW 13 112729257 missense possibly damaging 0.52
R0553:Slc38a9 UTSW 13 112714198 missense probably damaging 1.00
R0558:Slc38a9 UTSW 13 112729196 critical splice acceptor site probably null
R0699:Slc38a9 UTSW 13 112723289 missense probably damaging 1.00
R1036:Slc38a9 UTSW 13 112701659 splice site probably benign
R1142:Slc38a9 UTSW 13 112714210 missense probably damaging 1.00
R1344:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R1418:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R4223:Slc38a9 UTSW 13 112714248 critical splice donor site probably null
R4824:Slc38a9 UTSW 13 112723298 missense probably damaging 0.98
R4872:Slc38a9 UTSW 13 112689564 missense probably damaging 1.00
R5841:Slc38a9 UTSW 13 112695322 missense possibly damaging 0.76
R5844:Slc38a9 UTSW 13 112731501 missense probably damaging 1.00
R6039:Slc38a9 UTSW 13 112669697 missense probably damaging 1.00
R6039:Slc38a9 UTSW 13 112669697 missense probably damaging 1.00
R6151:Slc38a9 UTSW 13 112689376 missense probably damaging 1.00
R6166:Slc38a9 UTSW 13 112695267 missense possibly damaging 0.96
R6175:Slc38a9 UTSW 13 112703559 nonsense probably null
R6324:Slc38a9 UTSW 13 112726100 missense probably benign 0.01
R6747:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R6920:Slc38a9 UTSW 13 112701526 missense possibly damaging 0.63
R7342:Slc38a9 UTSW 13 112669591 start gained probably benign
R7592:Slc38a9 UTSW 13 112695355 missense probably damaging 0.99
R7787:Slc38a9 UTSW 13 112689346 missense probably damaging 0.99
R7860:Slc38a9 UTSW 13 112731614 missense probably benign
R7943:Slc38a9 UTSW 13 112731614 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTCATTACCAGCACTGAGTAG -3'
(R):5'- ACAGTCCCTTCTGTACCAGAG -3'

Sequencing Primer
(F):5'- ACTGAGTAGTGAATTTCAGTTTTGC -3'
(R):5'- ACCAGGGTGTACACTTGAAC -3'
Posted On2015-06-24