Incidental Mutation 'R4344:Dennd6b'
ID324273
Institutional Source Beutler Lab
Gene Symbol Dennd6b
Ensembl Gene ENSMUSG00000015377
Gene NameDENN/MADD domain containing 6B
SynonymsFam116b, 1700027J05Rik
MMRRC Submission 041101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R4344 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89182213-89196496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89188663 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 196 (A196V)
Ref Sequence ENSEMBL: ENSMUSP00000077978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078953] [ENSMUST00000229755]
Predicted Effect probably benign
Transcript: ENSMUST00000078953
AA Change: A196V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077978
Gene: ENSMUSG00000015377
AA Change: A196V

DomainStartEndE-ValueType
low complexity region 4 31 N/A INTRINSIC
Pfam:Avl9 42 181 1.1e-8 PFAM
Pfam:DENN 148 344 1.2e-8 PFAM
Pfam:SPA 248 358 6.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229416
Predicted Effect probably benign
Transcript: ENSMUST00000229755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230823
Meta Mutation Damage Score 0.2191 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,826,748 R5S possibly damaging Het
Ccdc187 T A 2: 26,280,669 K599I probably damaging Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cep19 C T 16: 32,107,065 T97M probably damaging Het
Ces2a T G 8: 104,737,134 D159E probably damaging Het
Dcc G A 18: 71,374,490 A917V probably damaging Het
Dlgap3 T C 4: 127,214,348 S475P possibly damaging Het
Doc2a C T 7: 126,851,149 P156S probably damaging Het
Elmo1 T A 13: 20,261,552 probably null Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm8251 G A 1: 44,060,991 L316F possibly damaging Het
Klk1b8 C A 7: 43,945,762 probably benign Het
Lmcd1 T A 6: 112,288,007 probably benign Het
Lyst T A 13: 13,698,466 I2750K probably benign Het
Muc4 A G 16: 32,770,292 N2958S possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp1r16b G A 2: 158,749,186 V163I probably damaging Het
Prkdc T A 16: 15,768,022 W2475R probably damaging Het
Rad54l C T 4: 116,097,354 C684Y probably damaging Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rasef T A 4: 73,745,089 H167L probably damaging Het
Sh3bp2 T C 5: 34,555,542 F165L possibly damaging Het
Slc38a9 T C 13: 112,729,215 I482T probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttc39c T A 18: 12,728,610 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn2r22 C T 6: 123,637,797 G278D probably damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Yme1l1 G A 2: 23,173,061 A215T probably benign Het
Zmynd15 C T 11: 70,461,068 R38* probably null Het
Other mutations in Dennd6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02709:Dennd6b APN 15 89190922 splice site probably benign
IGL03109:Dennd6b APN 15 89184985 utr 3 prime probably benign
IGL03133:Dennd6b APN 15 89188523 critical splice acceptor site probably null
P0016:Dennd6b UTSW 15 89186977 missense probably benign
PIT4791001:Dennd6b UTSW 15 89186752 critical splice donor site probably null
R0025:Dennd6b UTSW 15 89186183 missense probably benign 0.11
R0025:Dennd6b UTSW 15 89186183 missense probably benign 0.11
R0268:Dennd6b UTSW 15 89196229 missense probably benign 0.01
R0344:Dennd6b UTSW 15 89196229 missense probably benign 0.01
R0391:Dennd6b UTSW 15 89187214 missense probably damaging 1.00
R1453:Dennd6b UTSW 15 89188872 missense probably damaging 0.99
R1655:Dennd6b UTSW 15 89196340 missense unknown
R1670:Dennd6b UTSW 15 89185337 intron probably benign
R1765:Dennd6b UTSW 15 89190303 nonsense probably null
R1968:Dennd6b UTSW 15 89190341 missense possibly damaging 0.63
R3692:Dennd6b UTSW 15 89186827 splice site probably benign
R4736:Dennd6b UTSW 15 89185592 missense probably benign 0.00
R5030:Dennd6b UTSW 15 89196251 missense possibly damaging 0.82
R5058:Dennd6b UTSW 15 89187350 missense possibly damaging 0.69
R5509:Dennd6b UTSW 15 89185022 missense probably damaging 1.00
R6005:Dennd6b UTSW 15 89188168 missense possibly damaging 0.91
R6160:Dennd6b UTSW 15 89188821 missense probably damaging 0.97
R6535:Dennd6b UTSW 15 89186367 missense probably damaging 1.00
R6646:Dennd6b UTSW 15 89186184 missense probably damaging 0.99
R7098:Dennd6b UTSW 15 89188687 missense probably damaging 1.00
R7169:Dennd6b UTSW 15 89188852 missense possibly damaging 0.80
R7381:Dennd6b UTSW 15 89186173 missense possibly damaging 0.84
R7706:Dennd6b UTSW 15 89185244 missense probably benign 0.19
R8070:Dennd6b UTSW 15 89185373 missense probably benign 0.29
X0063:Dennd6b UTSW 15 89185420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATTCCAGCTTGTCCACC -3'
(R):5'- CACAGTCTTTAGTGCTGGTGTCC -3'

Sequencing Primer
(F):5'- CCTGGATGGGATGCGCAC -3'
(R):5'- GGCTGTTTCAGTCACTCCTAAG -3'
Posted On2015-06-24