Incidental Mutation 'R4345:Il1r1'
ID324281
Institutional Source Beutler Lab
Gene Symbol Il1r1
Ensembl Gene ENSMUSG00000026072
Gene Nameinterleukin 1 receptor, type I
SynonymsIL-1R1, IL-iR, CD121a, IL-1 receptor alpha chain, Il1r-1
MMRRC Submission 041666-MU
Accession Numbers

Genbank: NM_008362, NM_001123382

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4345 (G1)
Quality Score219
Status Validated
Chromosome1
Chromosomal Location40225080-40317257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40297924 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 224 (D224G)
Ref Sequence ENSEMBL: ENSMUSP00000110443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027241] [ENSMUST00000114795]
Predicted Effect probably benign
Transcript: ENSMUST00000027241
AA Change: D227G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027241
Gene: ENSMUSG00000026072
AA Change: D227G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 38 117 2.94e-1 SMART
IG_like 132 218 5.56e0 SMART
IG 236 333 1.35e0 SMART
Blast:TIR 347 381 1e-7 BLAST
TIR 387 544 1.93e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114795
AA Change: D224G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110443
Gene: ENSMUSG00000026072
AA Change: D224G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 35 114 2.94e-1 SMART
IG_like 129 215 5.56e0 SMART
IG 233 330 1.35e0 SMART
Blast:TIR 344 378 1e-7 BLAST
TIR 384 541 1.93e-29 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine receptor that belongs to the interleukin-1 receptor family. The encoded protein is a receptor for interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist. It is an important mediator involved in many cytokine-induced immune and inflammatory responses. This gene is located in a cluster of related cytokine receptor genes on chromosome 2q12. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, reduced IL1b responsiveness, delayed tooth eruption, decreased susceptibility to experimental autoimmune uveoritinitis, decreased susceptibility to kidney reperfusion injury, and late onset obesity. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Gene trapped(1)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in Il1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Il1r1 APN 1 40313170 missense probably damaging 1.00
IGL01532:Il1r1 APN 1 40294928 critical splice donor site probably null
IGL01610:Il1r1 APN 1 40302400 missense probably benign 0.09
IGL01668:Il1r1 APN 1 40313329 missense probably benign 0.31
IGL01729:Il1r1 APN 1 40294826 missense probably damaging 1.00
IGL02201:Il1r1 APN 1 40313268 missense probably damaging 0.97
IGL02229:Il1r1 APN 1 40313358 missense probably damaging 0.99
IGL02428:Il1r1 APN 1 40313232 missense possibly damaging 0.74
IGL02902:Il1r1 APN 1 40302409 missense probably benign 0.09
G5030:Il1r1 UTSW 1 40313163 missense possibly damaging 0.80
R0604:Il1r1 UTSW 1 40282246 missense probably benign 0.36
R1515:Il1r1 UTSW 1 40293349 nonsense probably null
R1530:Il1r1 UTSW 1 40312361 missense probably benign 0.00
R1727:Il1r1 UTSW 1 40293264 missense probably benign 0.16
R1957:Il1r1 UTSW 1 40313140 nonsense probably null
R2163:Il1r1 UTSW 1 40294863 missense probably benign 0.00
R2313:Il1r1 UTSW 1 40313310 missense probably benign 0.19
R4622:Il1r1 UTSW 1 40312420 missense probably damaging 0.96
R4735:Il1r1 UTSW 1 40293295 missense probably benign 0.00
R5033:Il1r1 UTSW 1 40293524 missense probably damaging 1.00
R5586:Il1r1 UTSW 1 40225251 start gained probably benign
R6375:Il1r1 UTSW 1 40294890 missense probably damaging 1.00
R6383:Il1r1 UTSW 1 40313335 missense possibly damaging 0.58
R6618:Il1r1 UTSW 1 40300811 missense probably damaging 0.97
R7169:Il1r1 UTSW 1 40293359 critical splice donor site probably null
R7384:Il1r1 UTSW 1 40282261 missense possibly damaging 0.64
R7798:Il1r1 UTSW 1 40310366 missense probably benign
R8040:Il1r1 UTSW 1 40313349 missense probably benign 0.01
R8129:Il1r1 UTSW 1 40302287 missense probably benign 0.04
RF007:Il1r1 UTSW 1 40313278 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGGAGAATACCTGTATGG -3'
(R):5'- AGCGGAGAATGTGTCACCATC -3'

Sequencing Primer
(F):5'- GTATGGTCCAACCTTGCTTCAGG -3'
(R):5'- GAGAATGTGTCACCATCCCTCTGTAG -3'
Posted On2015-06-24