Incidental Mutation 'R4345:Lepr'
ID 324289
Institutional Source Beutler Lab
Gene Symbol Lepr
Ensembl Gene ENSMUSG00000057722
Gene Name leptin receptor
Synonyms obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
MMRRC Submission 041666-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4345 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 101717404-101815352 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 101765152 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]
AlphaFold P48356
Predicted Effect probably null
Transcript: ENSMUST00000037552
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102777
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106921
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128948
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 (GRCm38) W449R probably damaging Het
Astn1 T A 1: 158,502,032 (GRCm38) probably null Het
BC005561 A G 5: 104,521,449 (GRCm38) E1279G probably benign Het
C3ar1 T C 6: 122,850,700 (GRCm38) D186G probably damaging Het
Fbf1 A G 11: 116,147,742 (GRCm38) V851A probably benign Het
Foxp4 G A 17: 47,874,648 (GRCm38) T500M unknown Het
Gm5878 G A 6: 85,125,651 (GRCm38) R31* probably null Het
Gramd4 T C 15: 86,134,893 (GRCm38) S581P probably damaging Het
Heatr5b A T 17: 78,760,511 (GRCm38) V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 (GRCm38) E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 (GRCm38) D224G probably benign Het
Kcnv1 G A 15: 45,114,444 (GRCm38) T66M probably damaging Het
Lactb2 T A 1: 13,660,350 (GRCm38) Y34F probably damaging Het
Loxhd1 A G 18: 77,399,001 (GRCm38) I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 (GRCm38) probably null Het
Mcee T C 7: 64,411,938 (GRCm38) L109P probably damaging Het
Mier3 A G 13: 111,705,283 (GRCm38) D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 (GRCm38) Y64C probably damaging Het
Nfasc A G 1: 132,631,705 (GRCm38) F229S probably damaging Het
Nsd3 G C 8: 25,641,317 (GRCm38) G233R probably benign Het
Olfr1065 T A 2: 86,445,845 (GRCm38) I46F probably damaging Het
Olfr320 A G 11: 58,683,945 (GRCm38) D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 (GRCm38) T947A probably benign Het
Plod3 G C 5: 136,988,146 (GRCm38) A50P probably benign Het
Pno1 A G 11: 17,209,095 (GRCm38) S158P possibly damaging Het
Prr14l A G 5: 32,828,576 (GRCm38) S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 (GRCm38) E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 (GRCm38) S27P probably benign Het
Sri G T 5: 8,059,427 (GRCm38) probably null Het
Stard9 G A 2: 120,701,946 (GRCm38) V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 (GRCm38) D524G probably benign Het
Them4 A G 3: 94,329,865 (GRCm38) T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 (GRCm38) S568C probably damaging Het
Ttl T C 2: 129,075,858 (GRCm38) L80P probably damaging Het
Ttn G T 2: 76,756,316 (GRCm38) N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 (GRCm38) L670Q probably damaging Het
Usp4 T A 9: 108,368,023 (GRCm38) probably benign Het
Vmn1r72 T A 7: 11,670,036 (GRCm38) T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 (GRCm38) N376S probably benign Het
Zswim6 G T 13: 107,726,931 (GRCm38) noncoding transcript Het
Other mutations in Lepr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101,815,035 (GRCm38) missense probably benign
IGL01111:Lepr APN 4 101,814,655 (GRCm38) missense possibly damaging 0.77
IGL01324:Lepr APN 4 101,768,068 (GRCm38) missense probably benign 0.23
IGL01372:Lepr APN 4 101,735,577 (GRCm38) missense possibly damaging 0.67
IGL01626:Lepr APN 4 101,733,534 (GRCm38) missense probably benign 0.10
IGL01733:Lepr APN 4 101,765,082 (GRCm38) missense probably benign 0.00
IGL01815:Lepr APN 4 101,814,790 (GRCm38) missense possibly damaging 0.49
IGL01899:Lepr APN 4 101,779,987 (GRCm38) missense possibly damaging 0.86
IGL02138:Lepr APN 4 101,768,067 (GRCm38) missense probably damaging 0.98
IGL02161:Lepr APN 4 101,745,678 (GRCm38) missense probably damaging 0.97
IGL02653:Lepr APN 4 101,764,944 (GRCm38) missense probably benign 0.44
IGL02735:Lepr APN 4 101,782,638 (GRCm38) missense probably damaging 1.00
IGL03035:Lepr APN 4 101,764,980 (GRCm38) missense probably damaging 1.00
IGL03083:Lepr APN 4 101,814,679 (GRCm38) nonsense probably null
IGL03160:Lepr APN 4 101,764,906 (GRCm38) missense probably damaging 1.00
aufsetzigen UTSW 4 101,752,175 (GRCm38) missense probably damaging 1.00
beastly UTSW 4 101,814,591 (GRCm38) missense probably benign
business_class UTSW 4 101,764,872 (GRCm38) missense probably damaging 1.00
cherub UTSW 4 101,768,062 (GRCm38) missense probably benign 0.25
clodhopper UTSW 4 101,765,290 (GRCm38) splice site probably null
donner UTSW 4 101,815,201 (GRCm38) missense probably damaging 1.00
fluffy UTSW 4 101,792,023 (GRCm38) missense probably damaging 1.00
giant UTSW 4 101,765,152 (GRCm38) critical splice donor site probably null
gordo UTSW 4 101,765,305 (GRCm38) missense probably damaging 0.97
Immunoglutton UTSW 4 101,765,301 (GRCm38) splice site probably benign
Jumbo_shrimp UTSW 4 101,764,954 (GRCm38) nonsense probably null
lowleaning UTSW 4 101,814,391 (GRCm38) splice site probably null
odd UTSW 4 101,728,074 (GRCm38) splice site probably benign
paleo UTSW 4 101,745,645 (GRCm38) missense possibly damaging 0.94
R0140_Lepr_245 UTSW 4 101,768,067 (GRCm38) missense probably damaging 1.00
well-upholstered UTSW 4 101,772,958 (GRCm38) synonymous probably benign
worldly UTSW 4 101,768,228 (GRCm38) missense possibly damaging 0.96
PIT4651001:Lepr UTSW 4 101,791,997 (GRCm38) missense probably damaging 1.00
PIT4696001:Lepr UTSW 4 101,779,983 (GRCm38) missense probably benign 0.10
R0140:Lepr UTSW 4 101,768,067 (GRCm38) missense probably damaging 1.00
R0197:Lepr UTSW 4 101,752,152 (GRCm38) missense possibly damaging 0.64
R0279:Lepr UTSW 4 101,750,344 (GRCm38) missense probably benign 0.05
R0487:Lepr UTSW 4 101,768,093 (GRCm38) nonsense probably null
R0498:Lepr UTSW 4 101,745,692 (GRCm38) missense probably benign 0.01
R0506:Lepr UTSW 4 101,773,010 (GRCm38) splice site probably benign
R0512:Lepr UTSW 4 101,814,704 (GRCm38) missense possibly damaging 0.87
R0512:Lepr UTSW 4 101,792,019 (GRCm38) missense probably damaging 1.00
R0726:Lepr UTSW 4 101,764,934 (GRCm38) missense probably benign 0.01
R1054:Lepr UTSW 4 101,782,596 (GRCm38) missense probably damaging 0.97
R1109:Lepr UTSW 4 101,771,355 (GRCm38) missense probably damaging 1.00
R1398:Lepr UTSW 4 101,792,019 (GRCm38) missense probably damaging 1.00
R1464:Lepr UTSW 4 101,735,681 (GRCm38) missense probably benign 0.08
R1464:Lepr UTSW 4 101,735,681 (GRCm38) missense probably benign 0.08
R1519:Lepr UTSW 4 101,789,344 (GRCm38) missense probably damaging 0.97
R1602:Lepr UTSW 4 101,745,645 (GRCm38) missense possibly damaging 0.94
R1830:Lepr UTSW 4 101,735,677 (GRCm38) missense probably damaging 1.00
R1850:Lepr UTSW 4 101,733,423 (GRCm38) missense possibly damaging 0.67
R1918:Lepr UTSW 4 101,772,836 (GRCm38) missense probably benign 0.08
R1928:Lepr UTSW 4 101,782,730 (GRCm38) splice site probably benign
R2099:Lepr UTSW 4 101,772,988 (GRCm38) missense probably damaging 1.00
R2102:Lepr UTSW 4 101,772,981 (GRCm38) missense possibly damaging 0.95
R2175:Lepr UTSW 4 101,765,379 (GRCm38) missense probably benign 0.01
R2254:Lepr UTSW 4 101,815,112 (GRCm38) missense probably benign 0.26
R2396:Lepr UTSW 4 101,733,528 (GRCm38) missense probably benign 0.19
R2508:Lepr UTSW 4 101,790,896 (GRCm38) missense probably damaging 0.98
R2571:Lepr UTSW 4 101,768,172 (GRCm38) missense possibly damaging 0.96
R3790:Lepr UTSW 4 101,790,914 (GRCm38) splice site probably benign
R3882:Lepr UTSW 4 101,815,265 (GRCm38) missense probably damaging 1.00
R3933:Lepr UTSW 4 101,765,301 (GRCm38) splice site probably benign
R4211:Lepr UTSW 4 101,733,414 (GRCm38) missense probably benign 0.19
R4343:Lepr UTSW 4 101,765,152 (GRCm38) critical splice donor site probably null
R4544:Lepr UTSW 4 101,768,228 (GRCm38) missense possibly damaging 0.96
R4546:Lepr UTSW 4 101,814,641 (GRCm38) missense probably benign 0.35
R4724:Lepr UTSW 4 101,765,365 (GRCm38) nonsense probably null
R4797:Lepr UTSW 4 101,780,047 (GRCm38) missense possibly damaging 0.90
R4860:Lepr UTSW 4 101,789,337 (GRCm38) missense probably benign 0.14
R4860:Lepr UTSW 4 101,789,337 (GRCm38) missense probably benign 0.14
R4929:Lepr UTSW 4 101,815,117 (GRCm38) missense probably benign 0.00
R4939:Lepr UTSW 4 101,733,438 (GRCm38) missense possibly damaging 0.78
R5377:Lepr UTSW 4 101,815,019 (GRCm38) missense possibly damaging 0.71
R5520:Lepr UTSW 4 101,745,537 (GRCm38) missense probably benign 0.00
R5966:Lepr UTSW 4 101,792,127 (GRCm38) intron probably benign
R6092:Lepr UTSW 4 101,792,023 (GRCm38) missense probably damaging 1.00
R6130:Lepr UTSW 4 101,765,372 (GRCm38) missense probably damaging 0.99
R6168:Lepr UTSW 4 101,735,592 (GRCm38) missense probably damaging 0.99
R6232:Lepr UTSW 4 101,814,391 (GRCm38) splice site probably null
R6380:Lepr UTSW 4 101,764,954 (GRCm38) nonsense probably null
R6427:Lepr UTSW 4 101,774,257 (GRCm38) missense possibly damaging 0.47
R6428:Lepr UTSW 4 101,780,098 (GRCm38) missense probably damaging 1.00
R6641:Lepr UTSW 4 101,765,305 (GRCm38) missense probably damaging 0.97
R6650:Lepr UTSW 4 101,815,201 (GRCm38) missense probably damaging 1.00
R6859:Lepr UTSW 4 101,765,290 (GRCm38) splice site probably null
R7023:Lepr UTSW 4 101,789,287 (GRCm38) missense probably damaging 1.00
R7145:Lepr UTSW 4 101,752,197 (GRCm38) missense probably benign 0.00
R7174:Lepr UTSW 4 101,750,338 (GRCm38) missense probably benign 0.01
R7179:Lepr UTSW 4 101,745,659 (GRCm38) missense probably benign 0.06
R7189:Lepr UTSW 4 101,814,764 (GRCm38) missense probably benign 0.00
R7426:Lepr UTSW 4 101,745,656 (GRCm38) missense probably benign 0.03
R7531:Lepr UTSW 4 101,752,175 (GRCm38) missense probably damaging 1.00
R7620:Lepr UTSW 4 101,752,073 (GRCm38) missense probably benign 0.41
R7804:Lepr UTSW 4 101,782,586 (GRCm38) missense probably damaging 1.00
R8022:Lepr UTSW 4 101,782,557 (GRCm38) missense probably benign 0.32
R8142:Lepr UTSW 4 101,765,419 (GRCm38) missense possibly damaging 0.93
R8227:Lepr UTSW 4 101,771,362 (GRCm38) missense probably damaging 0.99
R8426:Lepr UTSW 4 101,814,644 (GRCm38) missense probably benign 0.12
R8447:Lepr UTSW 4 101,814,491 (GRCm38) missense probably benign 0.08
R8531:Lepr UTSW 4 101,765,415 (GRCm38) missense probably damaging 1.00
R8682:Lepr UTSW 4 101,792,072 (GRCm38) missense probably benign 0.00
R8897:Lepr UTSW 4 101,792,036 (GRCm38) missense probably damaging 0.98
R9096:Lepr UTSW 4 101,774,221 (GRCm38) missense possibly damaging 0.95
R9177:Lepr UTSW 4 101,745,601 (GRCm38) nonsense probably null
R9241:Lepr UTSW 4 101,814,591 (GRCm38) missense probably benign
R9604:Lepr UTSW 4 101,733,276 (GRCm38) missense probably benign 0.01
R9711:Lepr UTSW 4 101,735,654 (GRCm38) nonsense probably null
X0026:Lepr UTSW 4 101,733,327 (GRCm38) missense possibly damaging 0.47
Z1176:Lepr UTSW 4 101,745,614 (GRCm38) missense probably damaging 0.99
Z1177:Lepr UTSW 4 101,735,595 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAATCTAGCTGAGAAAATCCCTG -3'
(R):5'- GTGCTTCCCACTAGTGATTGG -3'

Sequencing Primer
(F):5'- CCCTGAGATACAGTACAGCATTGTG -3'
(R):5'- AAGTACCCGTCAGTTTCACATG -3'
Posted On 2015-06-24