Incidental Mutation 'R4345:Sri'
ID324290
Institutional Source Beutler Lab
Gene Symbol Sri
Ensembl Gene ENSMUSG00000003161
Gene Namesorcin
SynonymsSor, 2210417O06Rik, 2900070H08Rik
MMRRC Submission 041666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R4345 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location8046078-8069379 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to T at 8059427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088786] [ENSMUST00000148633]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000003245
Predicted Effect probably null
Transcript: ENSMUST00000088786
SMART Domains Protein: ENSMUSP00000086165
Gene: ENSMUSG00000003161

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EF-hand_5 30 43 8.7e-4 PFAM
EFh 59 87 6.75e0 SMART
EFh 89 117 1.02e-2 SMART
Blast:EFh 153 183 9e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145119
Predicted Effect probably null
Transcript: ENSMUST00000148633
SMART Domains Protein: ENSMUSP00000118221
Gene: ENSMUSG00000003161

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
Pfam:EF-hand_5 45 58 9.6e-4 PFAM
EFh 74 102 6.75e0 SMART
EFh 104 132 1.02e-2 SMART
Blast:EFh 168 198 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197065
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in Sri
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Sri APN 5 8063755 splice site probably null
IGL02442:Sri APN 5 8062411 missense probably damaging 1.00
IGL02661:Sri APN 5 8063252 splice site probably benign
IGL02675:Sri APN 5 8067534 missense probably damaging 1.00
R0847:Sri UTSW 5 8063755 splice site probably null
R0973:Sri UTSW 5 8059381 missense probably damaging 1.00
R0973:Sri UTSW 5 8059381 missense probably damaging 1.00
R0974:Sri UTSW 5 8059381 missense probably damaging 1.00
R1187:Sri UTSW 5 8059416 missense probably damaging 1.00
R2860:Sri UTSW 5 8067540 missense probably benign 0.26
R2861:Sri UTSW 5 8067540 missense probably benign 0.26
R3844:Sri UTSW 5 8064576 missense probably damaging 1.00
R4575:Sri UTSW 5 8063693 missense probably damaging 1.00
R4704:Sri UTSW 5 8062430 splice site probably null
R5878:Sri UTSW 5 8059353 missense probably damaging 1.00
R6257:Sri UTSW 5 8059596 splice site probably null
R6944:Sri UTSW 5 8063365 missense probably benign 0.09
R7716:Sri UTSW 5 8056641 critical splice donor site probably null
R7917:Sri UTSW 5 8063409 critical splice donor site probably null
R7929:Sri UTSW 5 8057652 intron probably benign
R7960:Sri UTSW 5 8064586 missense probably benign 0.04
R8316:Sri UTSW 5 8063317 missense probably damaging 0.96
X0061:Sri UTSW 5 8063368 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGAATGCAGACTGTTGTCATGAC -3'
(R):5'- AAGAAGTCCACTAACCTCTCTGG -3'

Sequencing Primer
(F):5'- AGGCATTCCTTTAAAGAAATGCTAC -3'
(R):5'- CCTCTCTGGTAAACTGAAATGGC -3'
Posted On2015-06-24