Incidental Mutation 'R4345:Mcee'
ID324297
Institutional Source Beutler Lab
Gene Symbol Mcee
Ensembl Gene ENSMUSG00000033429
Gene Namemethylmalonyl CoA epimerase
Synonyms
MMRRC Submission 041666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4345 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location64392607-64412125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64411938 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 109 (L109P)
Ref Sequence ENSEMBL: ENSMUSP00000146220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037205] [ENSMUST00000206194] [ENSMUST00000206882]
Predicted Effect probably damaging
Transcript: ENSMUST00000037205
AA Change: L163P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047855
Gene: ENSMUSG00000033429
AA Change: L163P

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:Glyoxalase 49 175 2.7e-14 PFAM
Pfam:Glyoxalase_3 50 166 5.1e-9 PFAM
Pfam:Glyoxalase_4 51 162 1.2e-20 PFAM
Pfam:Glyoxalase_2 55 175 1.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206194
AA Change: L109P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206882
Meta Mutation Damage Score 0.9594 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene catalyzes the interconversion of D- and L-methylmalonyl-CoA during the degradation of branched chain amino acids. odd chain-length fatty acids, and other metabolites. Mutations in this gene result in methylmalonyl-CoA epimerase deficiency, which is presented as mild to moderate methylmalonic aciduria. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in Mcee
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Mcee APN 7 64400318 missense probably damaging 0.96
R1809:Mcee UTSW 7 64400301 missense probably damaging 1.00
R6124:Mcee UTSW 7 64400275 missense probably damaging 1.00
R7070:Mcee UTSW 7 64400330 missense possibly damaging 0.55
R7380:Mcee UTSW 7 64411909 missense possibly damaging 0.70
R7640:Mcee UTSW 7 64411968 missense probably damaging 1.00
R8240:Mcee UTSW 7 64411917 missense possibly damaging 0.94
R8299:Mcee UTSW 7 64411873 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCAAACAGTAGCATTCGGTG -3'
(R):5'- CCTCACTAGACTAGATCCTGGAGAAG -3'

Sequencing Primer
(F):5'- GGTGTTTTATGATCTCAGATGCACCC -3'
(R):5'- AGGATATGGGAGATCTGTCTGAG -3'
Posted On2015-06-24