Incidental Mutation 'R4345:Slc9a5'
ID324299
Institutional Source Beutler Lab
Gene Symbol Slc9a5
Ensembl Gene ENSMUSG00000014786
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 5
SynonymsLOC277973
MMRRC Submission 041666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4345 (G1)
Quality Score130
Status Validated
Chromosome8
Chromosomal Location105348843-105369881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105349455 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 27 (S27P)
Ref Sequence ENSEMBL: ENSMUSP00000072893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014922] [ENSMUST00000073149]
Predicted Effect probably benign
Transcript: ENSMUST00000014922
SMART Domains Protein: ENSMUSP00000014922
Gene: ENSMUSG00000014778

DomainStartEndE-ValueType
PDB:3DAD|B 1 339 N/A PDB
Blast:Drf_GBD 85 216 1e-48 BLAST
SCOP:d1ee4a_ 120 240 4e-4 SMART
Blast:FH2 231 318 6e-38 BLAST
low complexity region 342 357 N/A INTRINSIC
Blast:FH2 386 483 2e-10 BLAST
low complexity region 514 532 N/A INTRINSIC
low complexity region 573 643 N/A INTRINSIC
FH2 648 1100 3.16e-121 SMART
low complexity region 1119 1130 N/A INTRINSIC
Blast:FH2 1135 1179 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073149
AA Change: S27P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072893
Gene: ENSMUSG00000014786
AA Change: S27P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 39 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 458 9.8e-89 PFAM
low complexity region 705 723 N/A INTRINSIC
low complexity region 807 823 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132777
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in Slc9a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Slc9a5 APN 8 105349443 missense probably damaging 0.99
IGL02339:Slc9a5 APN 8 105358459 missense probably damaging 1.00
IGL03220:Slc9a5 APN 8 105368020 missense probably benign 0.09
P0026:Slc9a5 UTSW 8 105355291 missense probably damaging 1.00
R0680:Slc9a5 UTSW 8 105355907 missense probably null 1.00
R0990:Slc9a5 UTSW 8 105359446 missense probably damaging 1.00
R1440:Slc9a5 UTSW 8 105355153 missense possibly damaging 0.91
R1625:Slc9a5 UTSW 8 105368123 missense possibly damaging 0.88
R1737:Slc9a5 UTSW 8 105368134 missense probably damaging 1.00
R4169:Slc9a5 UTSW 8 105357400 missense possibly damaging 0.77
R4209:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4210:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4211:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4665:Slc9a5 UTSW 8 105368128 missense probably damaging 1.00
R5058:Slc9a5 UTSW 8 105355858 missense probably benign 0.03
R5553:Slc9a5 UTSW 8 105357040 missense probably damaging 1.00
R5574:Slc9a5 UTSW 8 105364691 missense probably benign 0.12
R5631:Slc9a5 UTSW 8 105349509 missense possibly damaging 0.73
R5645:Slc9a5 UTSW 8 105357013 missense probably benign 0.00
R5856:Slc9a5 UTSW 8 105357165 missense possibly damaging 0.58
R5907:Slc9a5 UTSW 8 105357175 critical splice donor site probably null
R6481:Slc9a5 UTSW 8 105358393 nonsense probably null
R6799:Slc9a5 UTSW 8 105363968 missense possibly damaging 0.84
R6834:Slc9a5 UTSW 8 105364684 missense probably benign 0.00
R6938:Slc9a5 UTSW 8 105353432 missense probably damaging 1.00
R7064:Slc9a5 UTSW 8 105349446 missense possibly damaging 0.91
R7095:Slc9a5 UTSW 8 105357636 missense probably benign 0.16
R7152:Slc9a5 UTSW 8 105368393 missense probably benign 0.03
R7303:Slc9a5 UTSW 8 105356713 missense probably damaging 0.99
R7508:Slc9a5 UTSW 8 105363253 splice site probably null
R7583:Slc9a5 UTSW 8 105363272 missense possibly damaging 0.62
R7895:Slc9a5 UTSW 8 105363366 missense probably damaging 1.00
R8077:Slc9a5 UTSW 8 105359380 missense probably damaging 1.00
R8217:Slc9a5 UTSW 8 105363324 missense probably damaging 0.97
X0058:Slc9a5 UTSW 8 105355305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTGCTAGGATCCTGGGC -3'
(R):5'- AAATCTGGAGACCTAGGGGC -3'

Sequencing Primer
(F):5'- ATCGGAGCTCGGATTGGG -3'
(R):5'- AGACCTAGGGGCTTGGGG -3'
Posted On2015-06-24