Incidental Mutation 'R4345:Usp4'
ID324301
Institutional Source Beutler Lab
Gene Symbol Usp4
Ensembl Gene ENSMUSG00000032612
Gene Nameubiquitin specific peptidase 4 (proto-oncogene)
SynonymsF730026I20Rik, Unp
MMRRC Submission 041666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R4345 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108347853-108392545 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 108368023 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035237] [ENSMUST00000194224] [ENSMUST00000194959]
Predicted Effect probably benign
Transcript: ENSMUST00000035237
SMART Domains Protein: ENSMUSP00000035237
Gene: ENSMUSG00000032612

DomainStartEndE-ValueType
DUSP 27 125 1.39e-46 SMART
Pfam:Ubiquitin_3 139 226 6.7e-34 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 919 2.2e-84 PFAM
Pfam:UCH_1 302 507 2.8e-8 PFAM
Pfam:UCH_1 605 901 1.4e-15 PFAM
low complexity region 927 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194065
Predicted Effect probably benign
Transcript: ENSMUST00000194224
SMART Domains Protein: ENSMUSP00000141321
Gene: ENSMUSG00000032612

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.3e-30 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 633 1.4e-50 PFAM
Pfam:UCH_1 302 520 2.3e-8 PFAM
low complexity region 657 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194959
SMART Domains Protein: ENSMUSP00000141368
Gene: ENSMUSG00000032612

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.7e-30 PFAM
Pfam:UCH 254 872 7e-89 PFAM
Pfam:UCH_1 255 469 3.5e-8 PFAM
Pfam:UCH_1 566 854 2.5e-14 PFAM
low complexity region 880 891 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased irradiation-induced apoptosis, slow cellular growth, resistance to oncogenic transformation, and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in Usp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Usp4 APN 9 108362900 critical splice donor site probably null
IGL01663:Usp4 APN 9 108365880 missense possibly damaging 0.80
IGL02105:Usp4 APN 9 108384932 missense probably damaging 1.00
IGL02486:Usp4 APN 9 108351029 missense probably damaging 1.00
R0148:Usp4 UTSW 9 108391671 splice site probably null
R0285:Usp4 UTSW 9 108378564 missense probably benign 0.33
R0591:Usp4 UTSW 9 108348029 splice site probably benign
R0594:Usp4 UTSW 9 108370881 intron probably null
R0616:Usp4 UTSW 9 108366804 missense probably benign
R1329:Usp4 UTSW 9 108372566 missense probably damaging 1.00
R1508:Usp4 UTSW 9 108372674 missense probably benign 0.14
R1752:Usp4 UTSW 9 108374242 missense probably damaging 1.00
R1824:Usp4 UTSW 9 108348008 missense probably damaging 1.00
R1846:Usp4 UTSW 9 108372736 missense probably benign
R2196:Usp4 UTSW 9 108373686 missense probably benign 0.07
R2925:Usp4 UTSW 9 108367856 missense probably damaging 1.00
R4126:Usp4 UTSW 9 108360117 missense probably benign 0.10
R4965:Usp4 UTSW 9 108362620 missense probably damaging 1.00
R4981:Usp4 UTSW 9 108381418 missense probably benign 0.00
R5110:Usp4 UTSW 9 108362678 missense probably damaging 1.00
R5580:Usp4 UTSW 9 108365859 missense probably benign 0.09
R5586:Usp4 UTSW 9 108356462 missense possibly damaging 0.95
R5927:Usp4 UTSW 9 108391760 missense probably benign 0.09
R6025:Usp4 UTSW 9 108360123 missense possibly damaging 0.70
R6112:Usp4 UTSW 9 108356504 missense probably damaging 1.00
R6197:Usp4 UTSW 9 108370955 missense probably damaging 1.00
R6742:Usp4 UTSW 9 108374239 missense possibly damaging 0.74
R7320:Usp4 UTSW 9 108388306 missense probably benign 0.00
R7458:Usp4 UTSW 9 108367856 missense probably damaging 1.00
R7531:Usp4 UTSW 9 108372680 missense probably damaging 1.00
R7563:Usp4 UTSW 9 108379344 missense probably benign
R8022:Usp4 UTSW 9 108378471 missense probably damaging 0.99
X0026:Usp4 UTSW 9 108347870 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGAAGGGTTGCAAGCTCTG -3'
(R):5'- AATATGAAGCCGCTCCCTTC -3'

Sequencing Primer
(F):5'- CCACTGACTGAGTACTTTCTCAAAG -3'
(R):5'- TTCCAACACGCAGGCTCAG -3'
Posted On2015-06-24