Incidental Mutation 'R4345:Pno1'
ID324302
Institutional Source Beutler Lab
Gene Symbol Pno1
Ensembl Gene ENSMUSG00000020116
Gene Namepartner of NOB1 homolog
SynonymsImi3, 1810003N24Rik, expressed during mesenchymal induction 3, Emi3
MMRRC Submission 041666-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4345 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location17203198-17211568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17209095 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 158 (S158P)
Ref Sequence ENSEMBL: ENSMUSP00000020317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020317] [ENSMUST00000046955]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020317
AA Change: S158P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020317
Gene: ENSMUSG00000020116
AA Change: S158P

DomainStartEndE-ValueType
KH 153 226 8.92e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046955
SMART Domains Protein: ENSMUSP00000040938
Gene: ENSMUSG00000078970

DomainStartEndE-ValueType
WD40 55 96 6.88e0 SMART
WD40 100 145 5.15e-2 SMART
Blast:WD40 149 196 8e-27 BLAST
WD40 199 240 2.54e2 SMART
WD40 246 288 2.06e0 SMART
WD40 310 350 7.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151431
Meta Mutation Damage Score 0.1671 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit eombryonic lethality between E3.5 and E6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in Pno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Pno1 APN 11 17211317 missense probably benign 0.00
IGL01475:Pno1 APN 11 17210992 missense probably damaging 1.00
IGL03166:Pno1 APN 11 17204513 splice site probably null
R0184:Pno1 UTSW 11 17211127 missense probably benign 0.00
R1302:Pno1 UTSW 11 17204545 missense probably benign 0.42
R1978:Pno1 UTSW 11 17204519 missense possibly damaging 0.57
R4586:Pno1 UTSW 11 17211438 missense probably benign 0.00
R7027:Pno1 UTSW 11 17208880 missense possibly damaging 0.63
R7890:Pno1 UTSW 11 17211443 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCTATTGCCCTTGACAGG -3'
(R):5'- ATGGTTGGGTCATTTTCCAGAC -3'

Sequencing Primer
(F):5'- GTCTCCTTTTAGGGGCTTAACTAAAG -3'
(R):5'- GGGTCATTTTCCAGACTTTTCG -3'
Posted On2015-06-24