Incidental Mutation 'R4345:Zswim6'
ID324306
Institutional Source Beutler Lab
Gene Symbol Zswim6
Ensembl Gene ENSMUSG00000032846
Gene Namezinc finger SWIM-type containing 6
Synonyms2900036G02Rik
MMRRC Submission 041666-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R4345 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location107724618-107890064 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to T at 107726931 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105097
SMART Domains Protein: ENSMUSP00000100724
Gene: ENSMUSG00000032846

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 43 71 N/A INTRINSIC
low complexity region 132 193 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225822
Meta Mutation Damage Score 0.0805 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, decreased striatal volume, abnormal medium spiny neuron morphology, and altered motor control including hyperactivity, impaired rotarod performance, repetitive movements, and behavioral hyperresponsiveness to amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Other mutations in Zswim6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Zswim6 APN 13 107728566 splice site noncoding transcript
IGL02367:Zswim6 APN 13 107744102 exon noncoding transcript
IGL02622:Zswim6 APN 13 107748251 exon noncoding transcript
IGL03000:Zswim6 APN 13 107727114 exon noncoding transcript
IGL03000:Zswim6 APN 13 107727115 exon noncoding transcript
R0069:Zswim6 UTSW 13 107738563 exon noncoding transcript
R0069:Zswim6 UTSW 13 107738563 exon noncoding transcript
R0834:Zswim6 UTSW 13 107726454 exon noncoding transcript
R1080:Zswim6 UTSW 13 107787651 critical splice donor site noncoding transcript
R1542:Zswim6 UTSW 13 107727234 exon noncoding transcript
R2081:Zswim6 UTSW 13 107773395 exon noncoding transcript
R2133:Zswim6 UTSW 13 107743987 exon noncoding transcript
R3692:Zswim6 UTSW 13 107726541 exon noncoding transcript
R4323:Zswim6 UTSW 13 107889403 exon noncoding transcript
R4369:Zswim6 UTSW 13 107726694 exon noncoding transcript
R5049:Zswim6 UTSW 13 107726575 exon noncoding transcript
R5111:Zswim6 UTSW 13 107728635 exon noncoding transcript
R5174:Zswim6 UTSW 13 107726681 exon noncoding transcript
R5531:Zswim6 UTSW 13 107769593 exon noncoding transcript
R5933:Zswim6 UTSW 13 107744107 exon noncoding transcript
R5934:Zswim6 UTSW 13 107744107 exon noncoding transcript
R6063:Zswim6 UTSW 13 107728577 exon noncoding transcript
R6168:Zswim6 UTSW 13 107787764 exon noncoding transcript
X0022:Zswim6 UTSW 13 107730324 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATGTCCGACAGTACCGTTGC -3'
(R):5'- GCCATCAACAGGAAAAGCTG -3'

Sequencing Primer
(F):5'- GACAGTACCGTTGCGCATTTGAC -3'
(R):5'- CATTGCAGTGCGCCATGAAG -3'
Posted On2015-06-24