Incidental Mutation 'R4345:Mier3'
ID324307
Institutional Source Beutler Lab
Gene Symbol Mier3
Ensembl Gene ENSMUSG00000032727
Gene NameMIER family member 3
Synonyms
MMRRC Submission 041666-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.632) question?
Stock #R4345 (G1)
Quality Score223
Status Validated
Chromosome13
Chromosomal Location111680979-111718596 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111705283 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 124 (D124G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047412] [ENSMUST00000109272] [ENSMUST00000137268] [ENSMUST00000231273] [ENSMUST00000231979]
Predicted Effect probably benign
Transcript: ENSMUST00000047412
AA Change: D99G

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036809
Gene: ENSMUSG00000032727
AA Change: D99G

DomainStartEndE-ValueType
low complexity region 53 65 N/A INTRINSIC
ELM2 149 203 8.33e-14 SMART
SANT 251 300 5.32e-9 SMART
low complexity region 509 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109271
AA Change: D124G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104894
Gene: ENSMUSG00000032727
AA Change: D124G

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
ELM2 175 229 8.33e-14 SMART
SANT 277 326 5.32e-9 SMART
low complexity region 535 548 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109272
AA Change: D126G

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104895
Gene: ENSMUSG00000032727
AA Change: D126G

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
ELM2 176 230 8.33e-14 SMART
SANT 279 328 5.32e-9 SMART
low complexity region 537 550 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137268
SMART Domains Protein: ENSMUSP00000117483
Gene: ENSMUSG00000032727

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000231273
AA Change: D99G

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231979
AA Change: D99G

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232560
Meta Mutation Damage Score 0.5169 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in Mier3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Mier3 APN 13 111714436 splice site probably benign
IGL03295:Mier3 APN 13 111703681 missense probably benign 0.00
IGL03054:Mier3 UTSW 13 111686314 start gained probably benign
R0119:Mier3 UTSW 13 111715038 missense probably damaging 1.00
R1106:Mier3 UTSW 13 111708229 missense probably damaging 1.00
R1453:Mier3 UTSW 13 111705244 missense probably damaging 1.00
R1463:Mier3 UTSW 13 111711755 missense probably damaging 0.99
R1555:Mier3 UTSW 13 111708359 missense probably damaging 0.98
R2413:Mier3 UTSW 13 111715128 utr 3 prime probably benign
R3055:Mier3 UTSW 13 111691303 missense probably damaging 1.00
R3114:Mier3 UTSW 13 111706648 missense probably damaging 0.98
R3115:Mier3 UTSW 13 111706648 missense probably damaging 0.98
R3116:Mier3 UTSW 13 111706648 missense probably damaging 0.98
R4834:Mier3 UTSW 13 111715109 nonsense probably null
R5050:Mier3 UTSW 13 111714573 missense possibly damaging 0.94
R5592:Mier3 UTSW 13 111706661 nonsense probably null
R5869:Mier3 UTSW 13 111714850 missense probably damaging 1.00
R6406:Mier3 UTSW 13 111709809 critical splice donor site probably null
R7151:Mier3 UTSW 13 111714768 missense probably benign 0.01
R7361:Mier3 UTSW 13 111705249 missense possibly damaging 0.91
R7362:Mier3 UTSW 13 111705249 missense possibly damaging 0.91
R7385:Mier3 UTSW 13 111705249 missense possibly damaging 0.91
R7683:Mier3 UTSW 13 111705312 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTTTTCAGAACCAGGGTGC -3'
(R):5'- CAGATGAAAACAGGCAGCCTTG -3'

Sequencing Primer
(F):5'- ACCAGGGTGCAAATTGGTTC -3'
(R):5'- GCAAAACTACCTGAGTGTATGGGTTC -3'
Posted On2015-06-24