Incidental Mutation 'R4345:Kcnv1'
ID324309
Institutional Source Beutler Lab
Gene Symbol Kcnv1
Ensembl Gene ENSMUSG00000022342
Gene Namepotassium channel, subfamily V, member 1
Synonyms2700023A03Rik
MMRRC Submission 041666-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4345 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location45106284-45114920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45114444 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 66 (T66M)
Ref Sequence ENSEMBL: ENSMUSP00000022967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022967]
Predicted Effect probably damaging
Transcript: ENSMUST00000022967
AA Change: T66M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022967
Gene: ENSMUSG00000022342
AA Change: T66M

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
BTB 42 160 1.17e-12 SMART
Pfam:Ion_trans 212 440 8.9e-45 PFAM
Pfam:Ion_trans_2 350 436 3.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228536
Meta Mutation Damage Score 0.9059 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This protein is essentially present in the brain, and its role might be to inhibit the function of a particular class of outward rectifier potassium channel types. [provided by RefSeq, Jul 2008]
PHENOTYPE: At weaning, homozygous mutant mice exhibit tetany, tremors and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Foxp4 G A 17: 47,874,648 T500M unknown Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in Kcnv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Kcnv1 APN 15 45113228 missense probably benign 0.00
IGL02227:Kcnv1 APN 15 45114274 missense probably damaging 1.00
IGL02472:Kcnv1 APN 15 45109123 nonsense probably null
IGL03239:Kcnv1 APN 15 45109490 splice site probably benign
R0079:Kcnv1 UTSW 15 45113333 missense probably damaging 1.00
R0534:Kcnv1 UTSW 15 45109249 missense probably damaging 0.98
R0627:Kcnv1 UTSW 15 45112881 splice site probably benign
R1614:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R1615:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R2942:Kcnv1 UTSW 15 45109185 missense probably damaging 1.00
R4244:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4290:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4291:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4293:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4294:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4295:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4335:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4342:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4354:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4934:Kcnv1 UTSW 15 45109248 missense probably damaging 1.00
R5240:Kcnv1 UTSW 15 45113244 missense probably damaging 1.00
R5295:Kcnv1 UTSW 15 45114591 missense unknown
R5631:Kcnv1 UTSW 15 45109357 missense probably damaging 1.00
R5669:Kcnv1 UTSW 15 45114252 missense possibly damaging 0.71
R5762:Kcnv1 UTSW 15 45109122 missense probably damaging 0.99
R5776:Kcnv1 UTSW 15 45114567 missense unknown
R5787:Kcnv1 UTSW 15 45114330 missense probably damaging 1.00
R5980:Kcnv1 UTSW 15 45109414 missense probably damaging 0.99
R6819:Kcnv1 UTSW 15 45109117 missense probably damaging 0.99
R6851:Kcnv1 UTSW 15 45109198 missense probably damaging 1.00
R6997:Kcnv1 UTSW 15 45114601 missense unknown
R7254:Kcnv1 UTSW 15 45113208 missense probably benign 0.00
R7258:Kcnv1 UTSW 15 45109315 missense probably damaging 0.99
R7272:Kcnv1 UTSW 15 45113180 missense probably benign 0.00
R7367:Kcnv1 UTSW 15 45109242 missense probably damaging 1.00
R7995:Kcnv1 UTSW 15 45109347 missense probably damaging 1.00
R8271:Kcnv1 UTSW 15 45109358 missense probably benign 0.00
X0026:Kcnv1 UTSW 15 45109467 missense possibly damaging 0.69
Z1177:Kcnv1 UTSW 15 45114435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCGATAGTAGTGCAGGAC -3'
(R):5'- CAACTTCCCAGTGCCTTCAG -3'

Sequencing Primer
(F):5'- TGCGATAGTAGTGCAGGACATAAC -3'
(R):5'- TCAGGATGGATCTGTCACCC -3'
Posted On2015-06-24