Incidental Mutation 'R4345:Foxp4'
ID324312
Institutional Source Beutler Lab
Gene Symbol Foxp4
Ensembl Gene ENSMUSG00000023991
Gene Nameforkhead box P4
Synonyms
MMRRC Submission 041666-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R4345 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location47867133-47924645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47874648 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 500 (T500M)
Ref Sequence ENSEMBL: ENSMUSP00000108890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097311] [ENSMUST00000113262] [ENSMUST00000113263] [ENSMUST00000113265]
Predicted Effect unknown
Transcript: ENSMUST00000097311
AA Change: T513M
SMART Domains Protein: ENSMUSP00000094916
Gene: ENSMUSG00000023991
AA Change: T513M

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 297 308 N/A INTRINSIC
ZnF_C2H2 313 338 3.47e0 SMART
FH 470 552 4.69e-38 SMART
low complexity region 644 658 N/A INTRINSIC
low complexity region 671 683 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113262
AA Change: T501M
SMART Domains Protein: ENSMUSP00000108887
Gene: ENSMUSG00000023991
AA Change: T501M

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 297 308 N/A INTRINSIC
ZnF_C2H2 313 338 3.47e0 SMART
FH 458 540 4.69e-38 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 659 671 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113263
AA Change: T511M
SMART Domains Protein: ENSMUSP00000108888
Gene: ENSMUSG00000023991
AA Change: T511M

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 171 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
ZnF_C2H2 311 336 3.47e0 SMART
FH 468 550 4.69e-38 SMART
low complexity region 642 656 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113265
AA Change: T500M
SMART Domains Protein: ENSMUSP00000108890
Gene: ENSMUSG00000023991
AA Change: T500M

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
internal_repeat_1 214 282 3.94e-5 PROSPERO
low complexity region 296 307 N/A INTRINSIC
ZnF_C2H2 312 337 3.47e0 SMART
FH 457 539 4.69e-38 SMART
internal_repeat_1 571 627 3.94e-5 PROSPERO
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154108
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to subfamily P of the forkhead box (FOX) transcription factor family. Forkhead box transcription factors play important roles in the regulation of tissue- and cell type-specific gene transcription during both development and adulthood. Many members of the forkhead box gene family, including members of subfamily P, have roles in mammalian oncogenesis. This gene may play a role in the development of tumors of the kidney and larynx. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die before E12.5. Foregut closure is delayed leading to the development of two beating hearts and to the failure of the trachea and esophagus to separate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap2 T C 12: 21,230,831 W449R probably damaging Het
Astn1 T A 1: 158,502,032 probably null Het
BC005561 A G 5: 104,521,449 E1279G probably benign Het
C3ar1 T C 6: 122,850,700 D186G probably damaging Het
Fbf1 A G 11: 116,147,742 V851A probably benign Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gramd4 T C 15: 86,134,893 S581P probably damaging Het
Heatr5b A T 17: 78,760,511 V1816E possibly damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Il1r1 A G 1: 40,297,924 D224G probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lactb2 T A 1: 13,660,350 Y34F probably damaging Het
Lepr G A 4: 101,765,152 probably null Het
Loxhd1 A G 18: 77,399,001 I1261V possibly damaging Het
Map4k3 A G 17: 80,597,551 probably null Het
Mcee T C 7: 64,411,938 L109P probably damaging Het
Mier3 A G 13: 111,705,283 D124G probably damaging Het
Mrpl43 T C 19: 45,006,110 Y64C probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nsd3 G C 8: 25,641,317 G233R probably benign Het
Olfr1065 T A 2: 86,445,845 I46F probably damaging Het
Olfr320 A G 11: 58,683,945 D24G possibly damaging Het
Pdzd8 T C 19: 59,300,128 T947A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Pno1 A G 11: 17,209,095 S158P possibly damaging Het
Prr14l A G 5: 32,828,576 S1192P probably damaging Het
Setbp1 T A 18: 79,086,579 E146V probably damaging Het
Slc9a5 T C 8: 105,349,455 S27P probably benign Het
Sri G T 5: 8,059,427 probably null Het
Stard9 G A 2: 120,701,946 V2895I probably benign Het
Tgfbrap1 T C 1: 43,056,706 D524G probably benign Het
Them4 A G 3: 94,329,865 T211A possibly damaging Het
Trpm3 A T 19: 22,897,697 S568C probably damaging Het
Ttl T C 2: 129,075,858 L80P probably damaging Het
Ttn G T 2: 76,756,316 N13423K possibly damaging Het
Usp10 T A 8: 119,954,814 L670Q probably damaging Het
Usp4 T A 9: 108,368,023 probably benign Het
Vmn1r72 T A 7: 11,670,036 T162S possibly damaging Het
Zmym5 T C 14: 56,796,626 N376S probably benign Het
Zswim6 G T 13: 107,726,931 noncoding transcript Het
Other mutations in Foxp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Foxp4 APN 17 47888153 missense probably damaging 1.00
IGL02454:Foxp4 APN 17 47875582 nonsense probably null
IGL03048:Foxp4 UTSW 17 47880840 missense unknown
R0138:Foxp4 UTSW 17 47869179 missense unknown
R1180:Foxp4 UTSW 17 47880353 splice site probably benign
R1268:Foxp4 UTSW 17 47880353 splice site probably benign
R1282:Foxp4 UTSW 17 47875643 missense unknown
R1494:Foxp4 UTSW 17 47880353 splice site probably benign
R1845:Foxp4 UTSW 17 47877959 missense probably null
R1956:Foxp4 UTSW 17 47875871 missense unknown
R1958:Foxp4 UTSW 17 47875871 missense unknown
R1969:Foxp4 UTSW 17 47875871 missense unknown
R1970:Foxp4 UTSW 17 47875871 missense unknown
R1971:Foxp4 UTSW 17 47875871 missense unknown
R2240:Foxp4 UTSW 17 47871276 missense unknown
R3847:Foxp4 UTSW 17 47875528 missense unknown
R3848:Foxp4 UTSW 17 47875528 missense unknown
R3849:Foxp4 UTSW 17 47875528 missense unknown
R5572:Foxp4 UTSW 17 47880879 missense unknown
R5726:Foxp4 UTSW 17 47869108 missense unknown
R6386:Foxp4 UTSW 17 47878462 missense unknown
R6510:Foxp4 UTSW 17 47875410 missense unknown
R8087:Foxp4 UTSW 17 47904430 missense probably damaging 1.00
R8290:Foxp4 UTSW 17 47880853 missense unknown
X0025:Foxp4 UTSW 17 47877965 missense unknown
Predicted Primers PCR Primer
(F):5'- AACACTGGAGTTGCTGCTG -3'
(R):5'- ATTAGCCTAGCGGGGAATCC -3'

Sequencing Primer
(F):5'- AGTTGCTGCTGAGGGGAC -3'
(R):5'- TGGGTCTCCTGTCCTCAAGG -3'
Posted On2015-06-24