Mutagenetix > Incidental Mutations

Incidental Mutation 'R4345:Pdzd8'

324318

Institutional Source

Beutler Lab

Gene Symbol

Pdzd8

Ensembl Gene

ENSMUSG00000074746

Gene Name

PDZ domain containing 8

Synonyms

A630041P07Rik, Pdzk8

MMRRC Submission

041666-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4345 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59296084-59345780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59300128 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 947 (T947A)

Ref Sequence

ENSEMBL: ENSMUSP00000096880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026084] [ENSMUST00000099274]

AlphaFold

B9EJ80

Predicted Effect

probably benign
Transcript: ENSMUST00000026084

SMART Domains

Protein: ENSMUSP00000026084
Gene: ENSMUSG00000025094

Domain	Start	End	E-Value	Type
Pfam:MFS_1	22	428	6.8e-40	PFAM
Pfam:Sugar_tr	26	284	5.9e-10	PFAM
Pfam:MFS_2	127	457	4.3e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099274
AA Change: T947A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: T947A

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
low complexity region	75	90	N/A	INTRINSIC
PDZ	374	448	2.02e-10	SMART
low complexity region	582	596	N/A	INTRINSIC
low complexity region	802	814	N/A	INTRINSIC
C1	834	884	8.31e-8	SMART
coiled coil region	1021	1057	N/A	INTRINSIC

Meta Mutation Damage Score

0.0582

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

96% (47/49)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asap2	T	C	12: 21,230,831	W449R	probably damaging	Het
Astn1	T	A	1: 158,502,032		probably null	Het
BC005561	A	G	5: 104,521,449	E1279G	probably benign	Het
C3ar1	T	C	6: 122,850,700	D186G	probably damaging	Het
Fbf1	A	G	11: 116,147,742	V851A	probably benign	Het
Foxp4	G	A	17: 47,874,648	T500M	unknown	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gramd4	T	C	15: 86,134,893	S581P	probably damaging	Het
Heatr5b	A	T	17: 78,760,511	V1816E	possibly damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Il1r1	A	G	1: 40,297,924	D224G	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Lactb2	T	A	1: 13,660,350	Y34F	probably damaging	Het
Lepr	G	A	4: 101,765,152		probably null	Het
Loxhd1	A	G	18: 77,399,001	I1261V	possibly damaging	Het
Map4k3	A	G	17: 80,597,551		probably null	Het
Mcee	T	C	7: 64,411,938	L109P	probably damaging	Het
Mier3	A	G	13: 111,705,283	D124G	probably damaging	Het
Mrpl43	T	C	19: 45,006,110	Y64C	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nsd3	G	C	8: 25,641,317	G233R	probably benign	Het
Olfr1065	T	A	2: 86,445,845	I46F	probably damaging	Het
Olfr320	A	G	11: 58,683,945	D24G	possibly damaging	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Pno1	A	G	11: 17,209,095	S158P	possibly damaging	Het
Prr14l	A	G	5: 32,828,576	S1192P	probably damaging	Het
Setbp1	T	A	18: 79,086,579	E146V	probably damaging	Het
Slc9a5	T	C	8: 105,349,455	S27P	probably benign	Het
Sri	G	T	5: 8,059,427		probably null	Het
Stard9	G	A	2: 120,701,946	V2895I	probably benign	Het
Tgfbrap1	T	C	1: 43,056,706	D524G	probably benign	Het
Them4	A	G	3: 94,329,865	T211A	possibly damaging	Het
Trpm3	A	T	19: 22,897,697	S568C	probably damaging	Het
Ttl	T	C	2: 129,075,858	L80P	probably damaging	Het
Ttn	G	T	2: 76,756,316	N13423K	possibly damaging	Het
Usp10	T	A	8: 119,954,814	L670Q	probably damaging	Het
Usp4	T	A	9: 108,368,023		probably benign	Het
Vmn1r72	T	A	7: 11,670,036	T162S	possibly damaging	Het
Zmym5	T	C	14: 56,796,626	N376S	probably benign	Het
Zswim6	G	T	13: 107,726,931		noncoding transcript	Het

Other mutations in Pdzd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01293:Pdzd8	APN	19	59299786	missense	probably damaging	1.00
IGL01321:Pdzd8	APN	19	59301529	missense	probably benign
IGL01865:Pdzd8	APN	19	59299645	missense	possibly damaging	0.92
IGL02044:Pdzd8	APN	19	59315292	missense	possibly damaging	0.85
IGL02119:Pdzd8	APN	19	59300490	missense	possibly damaging	0.95
IGL02186:Pdzd8	APN	19	59300628	missense	probably damaging	1.00
IGL02389:Pdzd8	APN	19	59301393	missense	probably benign	0.00
IGL02479:Pdzd8	APN	19	59299783	nonsense	probably null
IGL02713:Pdzd8	APN	19	59345458	missense	probably damaging	0.98
IGL02958:Pdzd8	APN	19	59300372	nonsense	probably null
IGL02966:Pdzd8	APN	19	59300859	missense	probably damaging	1.00
IGL03166:Pdzd8	APN	19	59300508	missense	probably damaging	1.00
citadel	UTSW	19	59299525	makesense	probably null
Eleventh_hour	UTSW	19	59305230	missense	probably damaging	1.00
keep	UTSW	19	59301351	nonsense	probably null
Stronghold	UTSW	19	59345352	nonsense	probably null
R0018:Pdzd8	UTSW	19	59300673	missense	probably damaging	1.00
R0038:Pdzd8	UTSW	19	59299596	missense	possibly damaging	0.54
R0196:Pdzd8	UTSW	19	59301131	missense	probably benign	0.00
R0233:Pdzd8	UTSW	19	59300379	missense	probably damaging	0.99
R0233:Pdzd8	UTSW	19	59300379	missense	probably damaging	0.99
R0418:Pdzd8	UTSW	19	59300929	missense	probably damaging	1.00
R0736:Pdzd8	UTSW	19	59344933	missense	probably damaging	0.99
R1456:Pdzd8	UTSW	19	59300472	missense	probably benign	0.01
R1709:Pdzd8	UTSW	19	59301339	missense	probably benign
R1965:Pdzd8	UTSW	19	59300122	missense	probably benign	0.37
R2155:Pdzd8	UTSW	19	59300421	missense	probably damaging	1.00
R3077:Pdzd8	UTSW	19	59305156	critical splice donor site	probably null
R3411:Pdzd8	UTSW	19	59345413	missense	probably damaging	1.00
R4354:Pdzd8	UTSW	19	59345481	missense	probably benign
R4504:Pdzd8	UTSW	19	59345448	missense	probably damaging	1.00
R4642:Pdzd8	UTSW	19	59305230	missense	probably damaging	1.00
R4705:Pdzd8	UTSW	19	59345311	missense	possibly damaging	0.80
R4773:Pdzd8	UTSW	19	59300860	missense	probably damaging	1.00
R4876:Pdzd8	UTSW	19	59300804	nonsense	probably null
R5176:Pdzd8	UTSW	19	59344957	missense	probably damaging	1.00
R5267:Pdzd8	UTSW	19	59301026	missense	probably damaging	1.00
R5707:Pdzd8	UTSW	19	59299625	missense	probably benign	0.00
R5766:Pdzd8	UTSW	19	59300540	missense	possibly damaging	0.65
R5903:Pdzd8	UTSW	19	59345286	missense	possibly damaging	0.58
R6036:Pdzd8	UTSW	19	59305209	missense	probably damaging	1.00
R6036:Pdzd8	UTSW	19	59305209	missense	probably damaging	1.00
R6238:Pdzd8	UTSW	19	59300562	missense	probably benign	0.05
R6360:Pdzd8	UTSW	19	59300983	missense	probably benign	0.10
R6509:Pdzd8	UTSW	19	59344866	missense	probably benign	0.01
R6674:Pdzd8	UTSW	19	59301369	missense	probably damaging	1.00
R6808:Pdzd8	UTSW	19	59299525	makesense	probably null
R6902:Pdzd8	UTSW	19	59301397	missense	possibly damaging	0.91
R7017:Pdzd8	UTSW	19	59345352	nonsense	probably null
R7088:Pdzd8	UTSW	19	59344957	missense	probably damaging	1.00
R7116:Pdzd8	UTSW	19	59299693	missense	probably damaging	1.00
R7158:Pdzd8	UTSW	19	59300157	missense	probably damaging	1.00
R7237:Pdzd8	UTSW	19	59345139	missense	probably damaging	1.00
R7251:Pdzd8	UTSW	19	59300645	missense	possibly damaging	0.96
R7314:Pdzd8	UTSW	19	59301351	nonsense	probably null
R7699:Pdzd8	UTSW	19	59344941	missense	probably damaging	1.00
R7751:Pdzd8	UTSW	19	59344776	missense	probably damaging	0.98
R7759:Pdzd8	UTSW	19	59299926	missense	probably damaging	1.00
R7784:Pdzd8	UTSW	19	59327863	missense	probably damaging	1.00
R7917:Pdzd8	UTSW	19	59345086	missense	probably damaging	0.96
R9364:Pdzd8	UTSW	19	59345142	missense	probably damaging	1.00
R9368:Pdzd8	UTSW	19	59300787	nonsense	probably null
R9406:Pdzd8	UTSW	19	59344813	missense

Predicted Primers

PCR Primer
(F):5'- ACAGATCACGACCAATTTCCTTTAC -3'
(R):5'- TTGTGGAGCAACTGAGAGGC -3'

Sequencing Primer
(F):5'- ACGACCAATTTCCTTTACTGCAATG -3'
(R):5'- GCGAATAGACCGGACCCTG -3'

Posted On

2015-06-24