Incidental Mutation 'R4346:Slc25a54'
ID324325
Institutional Source Beutler Lab
Gene Symbol Slc25a54
Ensembl Gene ENSMUSG00000027880
Gene Namesolute carrier family 25, member 54
Synonyms4930443G12Rik, SCaMC-1like
MMRRC Submission 041667-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R4346 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location109080469-109116687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109102739 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 185 (T185A)
Ref Sequence ENSEMBL: ENSMUSP00000029478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029478] [ENSMUST00000159926]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029478
AA Change: T185A

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029478
Gene: ENSMUSG00000027880
AA Change: T185A

DomainStartEndE-ValueType
EFh 23 51 4.28e0 SMART
EFh 59 87 3.82e0 SMART
EFh 90 118 4.12e-3 SMART
EFh 126 154 3.44e1 SMART
Pfam:Mito_carr 191 283 3.7e-25 PFAM
Pfam:Mito_carr 284 376 7.2e-24 PFAM
Pfam:Mito_carr 383 472 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159926
SMART Domains Protein: ENSMUSP00000124484
Gene: ENSMUSG00000027880

DomainStartEndE-ValueType
Blast:EFh 1 21 6e-9 BLAST
Pfam:Mito_carr 57 150 3.2e-26 PFAM
Pfam:Mito_carr 151 243 3.6e-25 PFAM
Pfam:Mito_carr 249 339 1.5e-16 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,247,965 V29M probably damaging Het
a G A 2: 155,045,731 R37Q probably benign Het
Adam12 T C 7: 133,981,535 T128A possibly damaging Het
Dnah8 A T 17: 30,725,098 Q1763L possibly damaging Het
Dvl3 G A 16: 20,531,299 R645H possibly damaging Het
Egflam A T 15: 7,234,278 C730* probably null Het
Fbxo40 T C 16: 36,970,163 E195G probably benign Het
Frmd4a T C 2: 4,608,033 S1025P possibly damaging Het
Gba2 A G 4: 43,571,337 V204A probably benign Het
Igkv8-28 C T 6: 70,144,112 probably benign Het
Lef1 T C 3: 131,194,708 M308T probably damaging Het
Map1a A G 2: 121,301,325 N874S probably benign Het
Med12l A T 3: 59,031,555 T37S probably damaging Het
Ogfod2 A G 5: 124,113,294 Y57C probably damaging Het
Olfr1442 A G 19: 12,674,228 T8A probably benign Het
Plxnd1 A G 6: 115,977,980 V607A probably benign Het
Pnpt1 A G 11: 29,145,478 D409G probably damaging Het
Pycrl G A 15: 75,918,731 T93I probably damaging Het
Ros1 A G 10: 52,168,609 Y201H possibly damaging Het
Smarcc2 A G 10: 128,468,823 I221V probably benign Het
Tnfrsf19 C A 14: 60,971,980 probably null Het
Ttll11 T C 2: 35,784,118 N599S probably benign Het
Ttn T G 2: 76,808,582 I13919L probably damaging Het
Vmn2r63 A G 7: 42,928,113 F334L possibly damaging Het
Vps13d A G 4: 145,072,529 probably benign Het
Zfp646 A G 7: 127,879,509 Y286C probably damaging Het
Other mutations in Slc25a54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Slc25a54 APN 3 109112860 missense possibly damaging 0.76
IGL02635:Slc25a54 APN 3 109112817 missense possibly damaging 0.71
IGL02944:Slc25a54 APN 3 109080615 missense probably benign 0.14
IGL02987:Slc25a54 APN 3 109116337 missense probably benign
IGL03346:Slc25a54 APN 3 109085730 intron probably benign
R0491:Slc25a54 UTSW 3 109102796 missense probably damaging 1.00
R0520:Slc25a54 UTSW 3 109107230 splice site probably benign
R0645:Slc25a54 UTSW 3 109112165 missense possibly damaging 0.70
R1803:Slc25a54 UTSW 3 109102697 missense probably benign
R1869:Slc25a54 UTSW 3 109080616 nonsense probably null
R1870:Slc25a54 UTSW 3 109080616 nonsense probably null
R3024:Slc25a54 UTSW 3 109080666 missense probably damaging 1.00
R3763:Slc25a54 UTSW 3 109112054 missense probably damaging 1.00
R3930:Slc25a54 UTSW 3 109116504 missense probably benign 0.03
R3941:Slc25a54 UTSW 3 109112163 missense probably damaging 1.00
R4347:Slc25a54 UTSW 3 109102739 missense possibly damaging 0.52
R4445:Slc25a54 UTSW 3 109098668 missense probably benign 0.00
R4735:Slc25a54 UTSW 3 109098607 missense probably damaging 0.96
R4914:Slc25a54 UTSW 3 109111079 missense probably benign 0.34
R4960:Slc25a54 UTSW 3 109112816 missense possibly damaging 0.95
R5052:Slc25a54 UTSW 3 109102700 missense probably benign 0.03
R5106:Slc25a54 UTSW 3 109112864 missense probably benign 0.02
R5806:Slc25a54 UTSW 3 109080578 missense probably benign
R5936:Slc25a54 UTSW 3 109098638 missense possibly damaging 0.88
R6511:Slc25a54 UTSW 3 109094256 missense possibly damaging 0.92
R6532:Slc25a54 UTSW 3 109112052 missense probably damaging 1.00
R6879:Slc25a54 UTSW 3 109112834 missense possibly damaging 0.94
R7139:Slc25a54 UTSW 3 109098589 missense probably damaging 1.00
R7179:Slc25a54 UTSW 3 109107257 missense probably benign 0.00
R7282:Slc25a54 UTSW 3 109116501 nonsense probably null
R7336:Slc25a54 UTSW 3 109116435 missense probably benign 0.00
R7355:Slc25a54 UTSW 3 109102769 missense probably damaging 1.00
R7713:Slc25a54 UTSW 3 109102817 missense probably damaging 0.99
R8061:Slc25a54 UTSW 3 109111045 missense probably damaging 1.00
R8282:Slc25a54 UTSW 3 109098689 critical splice donor site probably null
Z1176:Slc25a54 UTSW 3 109112118 frame shift probably null
Z1177:Slc25a54 UTSW 3 109102797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATCTTCAGTTTAGGAGGTGATC -3'
(R):5'- ACTAAGATATCTGCCAGGCAC -3'

Sequencing Primer
(F):5'- TCAGTTTAGGAGGTGATCTGAAAAAG -3'
(R):5'- GATATCTGCCAGGCACTTAAAATC -3'
Posted On2015-06-24