Incidental Mutation 'R4346:Lef1'
ID 324326
Institutional Source Beutler Lab
Gene Symbol Lef1
Ensembl Gene ENSMUSG00000027985
Gene Name lymphoid enhancer binding factor 1
Synonyms lymphoid enhancer factor 1, Lef-1
MMRRC Submission 041667-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4346 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 130904120-131018005 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130988357 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 308 (M308T)
Ref Sequence ENSEMBL: ENSMUSP00000029611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029611] [ENSMUST00000066849] [ENSMUST00000098611] [ENSMUST00000106341]
AlphaFold P27782
PDB Structure LEF1 HMG DOMAIN (FROM MOUSE), COMPLEXED WITH DNA (15BP), NMR, 12 STRUCTURES [SOLUTION NMR]
Structure of beta-catenin with Lef-1 [X-RAY DIFFRACTION]
Structure of beta-catenin with phosphorylated Lef-1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029611
AA Change: M308T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029611
Gene: ENSMUSG00000027985
AA Change: M308T

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 5e-88 PFAM
low complexity region 245 259 N/A INTRINSIC
HMG 296 366 7.68e-23 SMART
low complexity region 372 380 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066849
AA Change: M280T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067808
Gene: ENSMUSG00000027985
AA Change: M280T

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 1e-75 PFAM
low complexity region 217 231 N/A INTRINSIC
HMG 268 338 7.68e-23 SMART
low complexity region 344 352 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098611
AA Change: M242T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096211
Gene: ENSMUSG00000027985
AA Change: M242T

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 145 2.8e-54 PFAM
low complexity region 179 193 N/A INTRINSIC
HMG 230 300 7.68e-23 SMART
low complexity region 306 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106341
AA Change: M280T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101948
Gene: ENSMUSG00000027985
AA Change: M280T

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 1.3e-75 PFAM
low complexity region 217 231 N/A INTRINSIC
HMG 268 338 7.68e-23 SMART
low complexity region 344 352 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198624
Meta Mutation Damage Score 0.9561 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to a family of proteins that share homology with the high mobility group protein-1. The protein encoded by this gene can bind to a functionally important site in the T-cell receptor-alpha enhancer, thereby conferring maximal enhancer activity. This transcription factor is involved in the Wnt signaling pathway, and it may function in hair cell differentiation and follicle morphogenesis. Mutations in this gene have been found in somatic sebaceous tumors. This gene has also been linked to other cancers, including androgen-independent prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele are small and die postnatally showing lack of teeth, mammary and uterine glands, whiskers, body hair, dermal-associated fat, and a dentate gyrus, as well as defects in hippocampus morphology, hair follicle development, retinal vasculature, and vascular regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a G A 2: 154,887,651 (GRCm39) R37Q probably benign Het
Adam12 T C 7: 133,583,264 (GRCm39) T128A possibly damaging Het
Dnah8 A T 17: 30,944,072 (GRCm39) Q1763L possibly damaging Het
Dvl3 G A 16: 20,350,049 (GRCm39) R645H possibly damaging Het
Egflam A T 15: 7,263,759 (GRCm39) C730* probably null Het
Fbxo40 T C 16: 36,790,525 (GRCm39) E195G probably benign Het
Frmd4a T C 2: 4,612,844 (GRCm39) S1025P possibly damaging Het
Gba2 A G 4: 43,571,337 (GRCm39) V204A probably benign Het
Igkv8-28 C T 6: 70,121,096 (GRCm39) probably benign Het
Map1a A G 2: 121,131,806 (GRCm39) N874S probably benign Het
Med12l A T 3: 58,938,976 (GRCm39) T37S probably damaging Het
Ogfod2 A G 5: 124,251,357 (GRCm39) Y57C probably damaging Het
Or5b94 A G 19: 12,651,592 (GRCm39) T8A probably benign Het
Plxnd1 A G 6: 115,954,941 (GRCm39) V607A probably benign Het
Pnpt1 A G 11: 29,095,478 (GRCm39) D409G probably damaging Het
Pycr3 G A 15: 75,790,580 (GRCm39) T93I probably damaging Het
Ros1 A G 10: 52,044,705 (GRCm39) Y201H possibly damaging Het
Scart2 G A 7: 139,827,878 (GRCm39) V29M probably damaging Het
Slc25a54 A G 3: 109,010,055 (GRCm39) T185A possibly damaging Het
Smarcc2 A G 10: 128,304,692 (GRCm39) I221V probably benign Het
Tnfrsf19 C A 14: 61,209,429 (GRCm39) probably null Het
Ttll11 T C 2: 35,674,130 (GRCm39) N599S probably benign Het
Ttn T G 2: 76,638,926 (GRCm39) I13919L probably damaging Het
Vmn2r63 A G 7: 42,577,537 (GRCm39) F334L possibly damaging Het
Vps13d A G 4: 144,799,099 (GRCm39) probably benign Het
Zfp646 A G 7: 127,478,681 (GRCm39) Y286C probably damaging Het
Other mutations in Lef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Lef1 APN 3 130,907,499 (GRCm39) splice site probably benign
IGL00515:Lef1 APN 3 130,997,926 (GRCm39) missense probably damaging 1.00
IGL00780:Lef1 APN 3 130,986,779 (GRCm39) missense possibly damaging 0.69
IGL02057:Lef1 APN 3 130,994,051 (GRCm39) nonsense probably null
IGL02556:Lef1 APN 3 130,988,442 (GRCm39) splice site probably null
IGL02804:Lef1 APN 3 130,988,338 (GRCm39) missense probably damaging 1.00
IGL03143:Lef1 APN 3 130,993,965 (GRCm39) nonsense probably null
IGL03169:Lef1 APN 3 130,988,312 (GRCm39) missense probably damaging 1.00
R0470:Lef1 UTSW 3 130,906,475 (GRCm39) intron probably benign
R1354:Lef1 UTSW 3 130,988,317 (GRCm39) missense probably damaging 1.00
R1677:Lef1 UTSW 3 130,993,938 (GRCm39) splice site probably benign
R1860:Lef1 UTSW 3 130,905,290 (GRCm39) missense probably damaging 0.99
R2013:Lef1 UTSW 3 130,905,236 (GRCm39) missense probably damaging 0.98
R2015:Lef1 UTSW 3 130,905,236 (GRCm39) missense probably damaging 0.98
R3440:Lef1 UTSW 3 130,978,407 (GRCm39) missense probably damaging 1.00
R3736:Lef1 UTSW 3 130,984,715 (GRCm39) missense possibly damaging 0.51
R3918:Lef1 UTSW 3 130,905,290 (GRCm39) missense probably damaging 0.99
R4052:Lef1 UTSW 3 130,988,338 (GRCm39) missense probably damaging 1.00
R4608:Lef1 UTSW 3 130,978,382 (GRCm39) missense probably benign 0.00
R4764:Lef1 UTSW 3 130,978,382 (GRCm39) missense probably benign 0.00
R4786:Lef1 UTSW 3 130,905,173 (GRCm39) missense probably damaging 0.99
R5298:Lef1 UTSW 3 130,988,316 (GRCm39) missense possibly damaging 0.80
R5394:Lef1 UTSW 3 130,988,308 (GRCm39) missense probably damaging 1.00
R6827:Lef1 UTSW 3 130,994,053 (GRCm39) critical splice donor site probably null
R6893:Lef1 UTSW 3 130,909,149 (GRCm39) missense possibly damaging 0.77
R6974:Lef1 UTSW 3 130,905,223 (GRCm39) missense probably damaging 1.00
R7541:Lef1 UTSW 3 130,984,748 (GRCm39) missense probably benign 0.00
R7544:Lef1 UTSW 3 130,988,414 (GRCm39) missense probably damaging 1.00
R7652:Lef1 UTSW 3 130,994,003 (GRCm39) missense probably damaging 1.00
R8074:Lef1 UTSW 3 130,997,954 (GRCm39) critical splice donor site probably null
R8348:Lef1 UTSW 3 130,906,461 (GRCm39) start codon destroyed probably benign 0.02
R8543:Lef1 UTSW 3 130,909,138 (GRCm39) missense possibly damaging 0.92
R8762:Lef1 UTSW 3 130,988,366 (GRCm39) missense probably damaging 1.00
Z1176:Lef1 UTSW 3 130,993,972 (GRCm39) missense probably damaging 1.00
Z1177:Lef1 UTSW 3 130,986,830 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGGAATCTGGCAATGC -3'
(R):5'- CATTCAGGTATACGTACAAGTGGG -3'

Sequencing Primer
(F):5'- GGCAATGCCTACAGATCTTCTC -3'
(R):5'- GGTATACGTACAAGTGGGCACAC -3'
Posted On 2015-06-24