Incidental Mutation 'R4346:Pnpt1'
ID324338
Institutional Source Beutler Lab
Gene Symbol Pnpt1
Ensembl Gene ENSMUSG00000020464
Gene Namepolyribonucleotide nucleotidyltransferase 1
SynonymsPNPase, polynucleotide phosphorylase, 1200003F12Rik
MMRRC Submission 041667-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4346 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29130744-29161828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29145478 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 409 (D409G)
Ref Sequence ENSEMBL: ENSMUSP00000020756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020756]
PDB Structure
Solution structure of the alpha-helical domain from mouse hypothetical PNPase [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000020756
AA Change: D409G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020756
Gene: ENSMUSG00000020464
AA Change: D409G

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
Pfam:RNase_PH 52 183 1.9e-16 PFAM
Pfam:RNase_PH_C 186 251 3.8e-13 PFAM
Pfam:PNPase 282 363 3.7e-9 PFAM
Pfam:RNase_PH 366 501 3.4e-22 PFAM
Pfam:RNase_PH_C 504 581 7.1e-6 PFAM
KH 604 669 8e-7 SMART
S1 677 750 2.15e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154924
Meta Mutation Damage Score 0.9218 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionary conserved polynucleotide phosphorylase family comprised of phosphate dependent 3'-to-5' exoribonucleases implicated in RNA processing and degradation. This enzyme is predominantly localized in the mitochondrial intermembrane space and is involved in import of RNA to mitochondria. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency-13 and autosomal recessive nonsyndromic deafness-70. Related pseudogenes are found on chromosomes 3 and 7. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality and impaired mitochondrial RNA import. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,247,965 V29M probably damaging Het
a G A 2: 155,045,731 R37Q probably benign Het
Adam12 T C 7: 133,981,535 T128A possibly damaging Het
Dnah8 A T 17: 30,725,098 Q1763L possibly damaging Het
Dvl3 G A 16: 20,531,299 R645H possibly damaging Het
Egflam A T 15: 7,234,278 C730* probably null Het
Fbxo40 T C 16: 36,970,163 E195G probably benign Het
Frmd4a T C 2: 4,608,033 S1025P possibly damaging Het
Gba2 A G 4: 43,571,337 V204A probably benign Het
Igkv8-28 C T 6: 70,144,112 probably benign Het
Lef1 T C 3: 131,194,708 M308T probably damaging Het
Map1a A G 2: 121,301,325 N874S probably benign Het
Med12l A T 3: 59,031,555 T37S probably damaging Het
Ogfod2 A G 5: 124,113,294 Y57C probably damaging Het
Olfr1442 A G 19: 12,674,228 T8A probably benign Het
Plxnd1 A G 6: 115,977,980 V607A probably benign Het
Pycrl G A 15: 75,918,731 T93I probably damaging Het
Ros1 A G 10: 52,168,609 Y201H possibly damaging Het
Slc25a54 A G 3: 109,102,739 T185A possibly damaging Het
Smarcc2 A G 10: 128,468,823 I221V probably benign Het
Tnfrsf19 C A 14: 60,971,980 probably null Het
Ttll11 T C 2: 35,784,118 N599S probably benign Het
Ttn T G 2: 76,808,582 I13919L probably damaging Het
Vmn2r63 A G 7: 42,928,113 F334L possibly damaging Het
Vps13d A G 4: 145,072,529 probably benign Het
Zfp646 A G 7: 127,879,509 Y286C probably damaging Het
Other mutations in Pnpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pnpt1 APN 11 29154217 critical splice donor site probably null
IGL00920:Pnpt1 APN 11 29157087 splice site probably benign
IGL01358:Pnpt1 APN 11 29138425 missense possibly damaging 0.95
IGL01454:Pnpt1 APN 11 29137142 missense probably benign 0.19
IGL01622:Pnpt1 APN 11 29148272 splice site probably benign
IGL01623:Pnpt1 APN 11 29148272 splice site probably benign
IGL01674:Pnpt1 APN 11 29155787 missense probably benign 0.00
IGL01802:Pnpt1 APN 11 29154306 missense probably damaging 1.00
IGL02222:Pnpt1 APN 11 29159327 missense possibly damaging 0.71
IGL02222:Pnpt1 APN 11 29130842 missense probably benign 0.00
IGL02616:Pnpt1 APN 11 29135505 splice site probably benign
IGL02859:Pnpt1 APN 11 29138162 missense probably damaging 1.00
IGL02965:Pnpt1 APN 11 29156939 missense probably damaging 0.98
IGL03121:Pnpt1 APN 11 29132845 missense probably benign 0.03
PIT4651001:Pnpt1 UTSW 11 29156945 critical splice donor site probably null
R1023:Pnpt1 UTSW 11 29141328 splice site probably benign
R1477:Pnpt1 UTSW 11 29137102 missense probably benign 0.14
R1524:Pnpt1 UTSW 11 29130776 missense unknown
R1769:Pnpt1 UTSW 11 29154159 missense probably benign 0.22
R1839:Pnpt1 UTSW 11 29154342 missense possibly damaging 0.82
R1975:Pnpt1 UTSW 11 29141256 missense probably benign 0.16
R1977:Pnpt1 UTSW 11 29141256 missense probably benign 0.16
R1996:Pnpt1 UTSW 11 29141679 missense probably benign 0.01
R3771:Pnpt1 UTSW 11 29138174 missense probably benign 0.05
R4423:Pnpt1 UTSW 11 29153375 intron probably null
R5354:Pnpt1 UTSW 11 29154166 missense probably damaging 1.00
R5503:Pnpt1 UTSW 11 29138156 missense probably damaging 1.00
R5514:Pnpt1 UTSW 11 29153246 missense possibly damaging 0.82
R5908:Pnpt1 UTSW 11 29130887 missense probably benign 0.00
R6225:Pnpt1 UTSW 11 29145469 missense probably benign 0.38
R6605:Pnpt1 UTSW 11 29138567 missense possibly damaging 0.69
R7096:Pnpt1 UTSW 11 29154867 missense probably benign 0.03
R7214:Pnpt1 UTSW 11 29137285 missense probably damaging 1.00
R7365:Pnpt1 UTSW 11 29161334 missense probably damaging 1.00
R7492:Pnpt1 UTSW 11 29135522 missense probably benign 0.01
R7497:Pnpt1 UTSW 11 29130860 missense probably benign 0.00
R7686:Pnpt1 UTSW 11 29157070 missense probably damaging 0.97
Z1176:Pnpt1 UTSW 11 29145475 missense probably benign 0.00
Z1176:Pnpt1 UTSW 11 29145477 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AACTGCCATGGCTAGCACTG -3'
(R):5'- TTAGCCTAGACTACACAGCGAG -3'

Sequencing Primer
(F):5'- ATTCAAGGCCCTTGGATCAG -3'
(R):5'- GACTACACAGCGAGGCATTATTTC -3'
Posted On2015-06-24