Incidental Mutation 'R4326:Fastkd2'
ID 324346
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene Name FAST kinase domains 2
Synonyms 2810421I24Rik
MMRRC Submission 041096-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4326 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 63730614-63754655 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63752357 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 675 (K675E)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027102] [ENSMUST00000027103]
AlphaFold Q922E6
Predicted Effect probably benign
Transcript: ENSMUST00000027102
Predicted Effect probably benign
Transcript: ENSMUST00000027103
AA Change: K675E

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: K675E

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134454
Meta Mutation Damage Score 0.3333 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Abcd3 A G 3: 121,761,470 V616A probably benign Het
Abhd17a A G 10: 80,584,050 S241P probably benign Het
Adamts15 T C 9: 30,904,518 S681G probably benign Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Armc3 A G 2: 19,300,473 K681E probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atxn1 T C 13: 45,965,967 probably benign Het
Capn13 C A 17: 73,331,108 K433N probably benign Het
Ccdc113 G A 8: 95,557,268 M323I probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Dnah8 G A 17: 30,752,092 V2707M probably benign Het
Erlec1 C T 11: 30,949,972 E166K probably benign Het
Gid4 G A 11: 60,417,836 V61M possibly damaging Het
Glt28d2 G A 3: 85,872,086 Q27* probably null Het
Ipo8 A T 6: 148,800,164 probably benign Het
Isx A G 8: 74,873,656 I6V probably benign Het
Itsn1 A G 16: 91,853,855 probably benign Het
Klhl40 A G 9: 121,778,890 D372G probably benign Het
Krt80 C T 15: 101,352,308 V19M possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Lmo7 A T 14: 101,900,074 E504D possibly damaging Het
Lpcat4 G A 2: 112,246,392 E454K probably benign Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
Noxo1 G A 17: 24,698,963 R81H probably benign Het
Olfr479 T C 7: 108,055,155 Y58H probably damaging Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Pak1ip1 A G 13: 41,004,756 D35G possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Ppp2r2d T A 7: 138,868,485 V25D probably damaging Het
Prdm15 G T 16: 97,806,515 N709K probably damaging Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rrs1 G T 1: 9,546,341 R273L possibly damaging Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
Spen T G 4: 141,477,372 N1315H unknown Het
Ssrp1 A G 2: 85,040,217 probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Syne2 C A 12: 75,952,742 A2304E probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem62 T A 2: 120,980,510 N156K probably damaging Het
Wdr90 G T 17: 25,853,731 R884S probably benign Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63737771 splice site probably benign
IGL01890:Fastkd2 APN 1 63732161 missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63747999 missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63737924 splice site probably benign
IGL03208:Fastkd2 APN 1 63739206 missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63732028 missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63752400 missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63737811 missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63752340 missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63747955 splice site probably benign
R1468:Fastkd2 UTSW 1 63732226 unclassified probably benign
R1579:Fastkd2 UTSW 1 63745887 missense probably null 0.00
R1729:Fastkd2 UTSW 1 63751300 nonsense probably null
R3937:Fastkd2 UTSW 1 63737836 missense possibly damaging 0.48
R4327:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63735809 intron probably benign
R4473:Fastkd2 UTSW 1 63731674 missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63745886 missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63749896 intron probably benign
R5176:Fastkd2 UTSW 1 63731439 unclassified probably benign
R5478:Fastkd2 UTSW 1 63739186 missense probably benign 0.13
R5619:Fastkd2 UTSW 1 63739310 missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63731794 missense possibly damaging 0.75
R7038:Fastkd2 UTSW 1 63731873 missense possibly damaging 0.79
R7049:Fastkd2 UTSW 1 63731850 missense probably benign 0.04
R7510:Fastkd2 UTSW 1 63737789 missense possibly damaging 0.83
R7810:Fastkd2 UTSW 1 63731692 missense possibly damaging 0.61
R7889:Fastkd2 UTSW 1 63735460 splice site probably null
R8263:Fastkd2 UTSW 1 63731809 missense probably benign 0.03
R8271:Fastkd2 UTSW 1 63748024 missense probably benign 0.26
R8321:Fastkd2 UTSW 1 63747979 missense probably benign 0.00
R8468:Fastkd2 UTSW 1 63731764 missense probably benign 0.06
R8767:Fastkd2 UTSW 1 63735921 missense probably benign 0.00
Z1177:Fastkd2 UTSW 1 63734836 critical splice donor site probably null
Z1177:Fastkd2 UTSW 1 63734837 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGAATATGAACATGTGCATGGTG -3'
(R):5'- GGCTCTTCTGAAGTGTTTCCAG -3'

Sequencing Primer
(F):5'- GAACATGTGCATGGTGATATTTAATC -3'
(R):5'- GTGTTTCCAGTGTGTTCCAAAATACC -3'
Posted On 2015-06-24