Incidental Mutation 'R4326:Olfr479'
ID324362
Institutional Source Beutler Lab
Gene Symbol Olfr479
Ensembl Gene ENSMUSG00000043855
Gene Nameolfactory receptor 479
SynonymsMOR267-15, GA_x6K02T2PBJ9-10384085-10385068
MMRRC Submission 041096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4326 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108050693-108056783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108055155 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 58 (Y58H)
Ref Sequence ENSEMBL: ENSMUSP00000149060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063151] [ENSMUST00000209805] [ENSMUST00000214599]
Predicted Effect probably damaging
Transcript: ENSMUST00000063151
AA Change: Y58H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056631
Gene: ENSMUSG00000043855
AA Change: Y58H

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 7.5e-45 PFAM
Pfam:7tm_1 39 301 1.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209805
AA Change: Y58H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214599
AA Change: Y58H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Abcd3 A G 3: 121,761,470 V616A probably benign Het
Abhd17a A G 10: 80,584,050 S241P probably benign Het
Adamts15 T C 9: 30,904,518 S681G probably benign Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Armc3 A G 2: 19,300,473 K681E probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atxn1 T C 13: 45,965,967 probably benign Het
Capn13 C A 17: 73,331,108 K433N probably benign Het
Ccdc113 G A 8: 95,557,268 M323I probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Dnah8 G A 17: 30,752,092 V2707M probably benign Het
Erlec1 C T 11: 30,949,972 E166K probably benign Het
Fastkd2 A G 1: 63,752,357 K675E probably benign Het
Gid4 G A 11: 60,417,836 V61M possibly damaging Het
Glt28d2 G A 3: 85,872,086 Q27* probably null Het
Ipo8 A T 6: 148,800,164 probably benign Het
Isx A G 8: 74,873,656 I6V probably benign Het
Itsn1 A G 16: 91,853,855 probably benign Het
Klhl40 A G 9: 121,778,890 D372G probably benign Het
Krt80 C T 15: 101,352,308 V19M possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Lmo7 A T 14: 101,900,074 E504D possibly damaging Het
Lpcat4 G A 2: 112,246,392 E454K probably benign Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
Noxo1 G A 17: 24,698,963 R81H probably benign Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Pak1ip1 A G 13: 41,004,756 D35G possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Ppp2r2d T A 7: 138,868,485 V25D probably damaging Het
Prdm15 G T 16: 97,806,515 N709K probably damaging Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rrs1 G T 1: 9,546,341 R273L possibly damaging Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
Spen T G 4: 141,477,372 N1315H unknown Het
Ssrp1 A G 2: 85,040,217 probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Syne2 C A 12: 75,952,742 A2304E probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem62 T A 2: 120,980,510 N156K probably damaging Het
Wdr90 G T 17: 25,853,731 R884S probably benign Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in Olfr479
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Olfr479 APN 7 108055567 missense probably damaging 0.96
IGL01320:Olfr479 APN 7 108054981 utr 5 prime probably benign
IGL01322:Olfr479 APN 7 108054981 utr 5 prime probably benign
R0396:Olfr479 UTSW 7 108055963 missense probably benign 0.11
R0539:Olfr479 UTSW 7 108055822 missense probably damaging 1.00
R2129:Olfr479 UTSW 7 108055904 missense probably benign 0.25
R2246:Olfr479 UTSW 7 108055782 missense probably benign 0.00
R2247:Olfr479 UTSW 7 108055782 missense probably benign 0.00
R3149:Olfr479 UTSW 7 108055782 missense probably benign 0.00
R3709:Olfr479 UTSW 7 108055797 missense possibly damaging 0.63
R3714:Olfr479 UTSW 7 108055435 missense probably damaging 0.99
R4962:Olfr479 UTSW 7 108055440 missense probably benign 0.27
R5053:Olfr479 UTSW 7 108055534 missense probably benign 0.10
R5976:Olfr479 UTSW 7 108055798 missense possibly damaging 0.89
R6151:Olfr479 UTSW 7 108055899 missense probably benign
R6939:Olfr479 UTSW 7 108055105 missense possibly damaging 0.87
R7271:Olfr479 UTSW 7 108055216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGGTCAAAATTGCTGCC -3'
(R):5'- ATGGCAGTGTAACGGTCATAG -3'

Sequencing Primer
(F):5'- GGGTCAAAATTGCTGCCACCTAG -3'
(R):5'- GTCATAGGACATGGCAGCC -3'
Posted On2015-06-24