Incidental Mutation 'R4326:Tcf25'
ID324366
Institutional Source Beutler Lab
Gene Symbol Tcf25
Ensembl Gene ENSMUSG00000001472
Gene Nametranscription factor 25 (basic helix-loop-helix)
Synonyms1100001J13Rik, Nulp1, D8Ertd325e, 1810041K11Rik
MMRRC Submission 041096-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4326 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123373753-123403835 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 123401143 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 622 (L622*)
Ref Sequence ENSEMBL: ENSMUSP00000148454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057934] [ENSMUST00000108840] [ENSMUST00000127664] [ENSMUST00000211932] [ENSMUST00000212470] [ENSMUST00000212569] [ENSMUST00000212571] [ENSMUST00000212880]
Predicted Effect probably null
Transcript: ENSMUST00000057934
AA Change: L647*
SMART Domains Protein: ENSMUSP00000056485
Gene: ENSMUSG00000001472
AA Change: L647*

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 248 588 4.6e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108840
SMART Domains Protein: ENSMUSP00000104468
Gene: ENSMUSG00000001472

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 247 588 2.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211932
Predicted Effect probably benign
Transcript: ENSMUST00000212470
Predicted Effect probably null
Transcript: ENSMUST00000212569
AA Change: L622*
Predicted Effect probably benign
Transcript: ENSMUST00000212571
Predicted Effect probably benign
Transcript: ENSMUST00000212880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212996
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TCF25 is a member of the basic helix-loop-helix (bHLH) family of transcription factors that are important in embryonic development (Steen and Lindholm, 2008 [PubMed 18068114]).[supplied by OMIM, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Abcd3 A G 3: 121,761,470 V616A probably benign Het
Abhd17a A G 10: 80,584,050 S241P probably benign Het
Adamts15 T C 9: 30,904,518 S681G probably benign Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Armc3 A G 2: 19,300,473 K681E probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atxn1 T C 13: 45,965,967 probably benign Het
Capn13 C A 17: 73,331,108 K433N probably benign Het
Ccdc113 G A 8: 95,557,268 M323I probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Dnah8 G A 17: 30,752,092 V2707M probably benign Het
Erlec1 C T 11: 30,949,972 E166K probably benign Het
Fastkd2 A G 1: 63,752,357 K675E probably benign Het
Gid4 G A 11: 60,417,836 V61M possibly damaging Het
Glt28d2 G A 3: 85,872,086 Q27* probably null Het
Ipo8 A T 6: 148,800,164 probably benign Het
Isx A G 8: 74,873,656 I6V probably benign Het
Itsn1 A G 16: 91,853,855 probably benign Het
Klhl40 A G 9: 121,778,890 D372G probably benign Het
Krt80 C T 15: 101,352,308 V19M possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Lmo7 A T 14: 101,900,074 E504D possibly damaging Het
Lpcat4 G A 2: 112,246,392 E454K probably benign Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
Noxo1 G A 17: 24,698,963 R81H probably benign Het
Olfr479 T C 7: 108,055,155 Y58H probably damaging Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Pak1ip1 A G 13: 41,004,756 D35G possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Ppp2r2d T A 7: 138,868,485 V25D probably damaging Het
Prdm15 G T 16: 97,806,515 N709K probably damaging Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rrs1 G T 1: 9,546,341 R273L possibly damaging Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
Spen T G 4: 141,477,372 N1315H unknown Het
Ssrp1 A G 2: 85,040,217 probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Syne2 C A 12: 75,952,742 A2304E probably damaging Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem62 T A 2: 120,980,510 N156K probably damaging Het
Wdr90 G T 17: 25,853,731 R884S probably benign Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in Tcf25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Tcf25 APN 8 123393236 missense possibly damaging 0.87
IGL02638:Tcf25 APN 8 123399292 missense probably damaging 1.00
IGL03112:Tcf25 APN 8 123382519 splice site probably benign
R0492:Tcf25 UTSW 8 123381464 missense probably benign 0.00
R1081:Tcf25 UTSW 8 123381473 missense probably benign 0.00
R1543:Tcf25 UTSW 8 123388587 missense probably benign 0.01
R1634:Tcf25 UTSW 8 123397091 missense possibly damaging 0.68
R1662:Tcf25 UTSW 8 123381550 missense probably benign 0.00
R2253:Tcf25 UTSW 8 123374033 missense probably benign 0.21
R4327:Tcf25 UTSW 8 123401143 nonsense probably null
R4667:Tcf25 UTSW 8 123397025 missense possibly damaging 0.89
R4977:Tcf25 UTSW 8 123388635 missense probably benign 0.03
R5248:Tcf25 UTSW 8 123373939 missense probably damaging 1.00
R5249:Tcf25 UTSW 8 123388633 missense probably damaging 1.00
R5759:Tcf25 UTSW 8 123381457 missense probably benign 0.00
R5806:Tcf25 UTSW 8 123381504 missense probably benign 0.09
R5813:Tcf25 UTSW 8 123395615 unclassified probably null
R5905:Tcf25 UTSW 8 123381437 missense possibly damaging 0.78
R6028:Tcf25 UTSW 8 123381437 missense possibly damaging 0.78
R6114:Tcf25 UTSW 8 123384375 missense probably damaging 1.00
R6349:Tcf25 UTSW 8 123391593 missense probably damaging 1.00
R6904:Tcf25 UTSW 8 123400698 critical splice donor site probably null
R7232:Tcf25 UTSW 8 123401061 splice site probably null
R7287:Tcf25 UTSW 8 123373972 missense possibly damaging 0.74
RF007:Tcf25 UTSW 8 123395630 missense probably benign 0.03
Z1176:Tcf25 UTSW 8 123373906 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTCAATCTTGGGGCCTAAG -3'
(R):5'- GTATAACCCACTCCCTTCAGAGG -3'

Sequencing Primer
(F):5'- AAGTTGCCTCAGCCGTTGAAC -3'
(R):5'- ATGGTCAGCATTTCTACTCGGAAC -3'
Posted On2015-06-24