Incidental Mutation 'R4326:Adamts15'
ID 324368
Institutional Source Beutler Lab
Gene Symbol Adamts15
Ensembl Gene ENSMUSG00000033453
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15
Synonyms
MMRRC Submission 041096-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4326 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 30899155-30922452 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30904518 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 681 (S681G)
Ref Sequence ENSEMBL: ENSMUSP00000067022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065112]
AlphaFold P59384
Predicted Effect probably benign
Transcript: ENSMUST00000065112
AA Change: S681G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067022
Gene: ENSMUSG00000033453
AA Change: S681G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 24 157 8.7e-27 PFAM
Pfam:Reprolysin_4 216 422 8.2e-7 PFAM
Pfam:Reprolysin_5 217 404 7.2e-13 PFAM
Pfam:Reprolysin 218 427 3.7e-20 PFAM
Pfam:Reprolysin_3 240 372 6.1e-10 PFAM
Blast:ACR 429 507 1e-25 BLAST
TSP1 519 571 7.85e-12 SMART
Pfam:ADAM_spacer1 683 801 7.1e-36 PFAM
TSP1 842 895 3e-8 SMART
TSP1 896 949 4.21e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217070
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active versicanase enzyme. This gene is located adjacent to a related ADAMTS gene (Adamts8) on chromosome 9. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Abcd3 A G 3: 121,761,470 V616A probably benign Het
Abhd17a A G 10: 80,584,050 S241P probably benign Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Armc3 A G 2: 19,300,473 K681E probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atxn1 T C 13: 45,965,967 probably benign Het
Capn13 C A 17: 73,331,108 K433N probably benign Het
Ccdc113 G A 8: 95,557,268 M323I probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Dnah8 G A 17: 30,752,092 V2707M probably benign Het
Erlec1 C T 11: 30,949,972 E166K probably benign Het
Fastkd2 A G 1: 63,752,357 K675E probably benign Het
Gid4 G A 11: 60,417,836 V61M possibly damaging Het
Glt28d2 G A 3: 85,872,086 Q27* probably null Het
Ipo8 A T 6: 148,800,164 probably benign Het
Isx A G 8: 74,873,656 I6V probably benign Het
Itsn1 A G 16: 91,853,855 probably benign Het
Klhl40 A G 9: 121,778,890 D372G probably benign Het
Krt80 C T 15: 101,352,308 V19M possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Lmo7 A T 14: 101,900,074 E504D possibly damaging Het
Lpcat4 G A 2: 112,246,392 E454K probably benign Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
Noxo1 G A 17: 24,698,963 R81H probably benign Het
Olfr479 T C 7: 108,055,155 Y58H probably damaging Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Pak1ip1 A G 13: 41,004,756 D35G possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Ppp2r2d T A 7: 138,868,485 V25D probably damaging Het
Prdm15 G T 16: 97,806,515 N709K probably damaging Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rrs1 G T 1: 9,546,341 R273L possibly damaging Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
Spen T G 4: 141,477,372 N1315H unknown Het
Ssrp1 A G 2: 85,040,217 probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Syne2 C A 12: 75,952,742 A2304E probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem62 T A 2: 120,980,510 N156K probably damaging Het
Wdr90 G T 17: 25,853,731 R884S probably benign Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in Adamts15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Adamts15 APN 9 30902053 missense probably damaging 1.00
IGL01325:Adamts15 APN 9 30921688 missense possibly damaging 0.86
IGL01506:Adamts15 APN 9 30922134 missense probably benign 0.08
IGL01897:Adamts15 APN 9 30902152 missense probably damaging 1.00
IGL02137:Adamts15 APN 9 30910660 missense probably damaging 1.00
IGL02876:Adamts15 APN 9 30904522 missense probably damaging 0.98
IGL02997:Adamts15 APN 9 30906057 splice site probably benign
IGL03094:Adamts15 APN 9 30904472 splice site probably benign
IGL03146:Adamts15 APN 9 30921567 missense probably damaging 0.99
IGL03241:Adamts15 APN 9 30904485 missense probably damaging 1.00
Awareness UTSW 9 30911108 critical splice donor site probably null
heightened UTSW 9 30904770 missense probably damaging 1.00
Pugsley UTSW 9 30906158 missense probably damaging 1.00
sparticus UTSW 9 30910602 missense probably benign 0.40
R0118:Adamts15 UTSW 9 30911744 missense probably damaging 1.00
R0635:Adamts15 UTSW 9 30904770 missense probably damaging 1.00
R0827:Adamts15 UTSW 9 30921480 missense probably damaging 1.00
R0946:Adamts15 UTSW 9 30902197 missense probably damaging 1.00
R1608:Adamts15 UTSW 9 30902479 missense probably damaging 0.99
R1806:Adamts15 UTSW 9 30904815 missense probably damaging 1.00
R1954:Adamts15 UTSW 9 30910708 missense probably benign
R1967:Adamts15 UTSW 9 30921309 nonsense probably null
R2009:Adamts15 UTSW 9 30922137 missense probably benign 0.17
R2129:Adamts15 UTSW 9 30904503 missense probably benign 0.05
R2329:Adamts15 UTSW 9 30902485 missense probably damaging 1.00
R2991:Adamts15 UTSW 9 30921394 missense probably benign
R3970:Adamts15 UTSW 9 30910602 missense probably benign 0.40
R4212:Adamts15 UTSW 9 30906174 missense probably damaging 0.99
R4329:Adamts15 UTSW 9 30904518 missense probably benign
R4594:Adamts15 UTSW 9 30921447 missense probably damaging 0.99
R5110:Adamts15 UTSW 9 30921444 missense probably benign 0.01
R5120:Adamts15 UTSW 9 30921576 missense probably damaging 1.00
R5697:Adamts15 UTSW 9 30911794 missense probably damaging 1.00
R5901:Adamts15 UTSW 9 30902490 missense probably damaging 1.00
R6011:Adamts15 UTSW 9 30902786 missense probably damaging 0.98
R6020:Adamts15 UTSW 9 30902062 missense probably benign 0.03
R6651:Adamts15 UTSW 9 30922152 missense probably damaging 0.98
R6665:Adamts15 UTSW 9 30904479 critical splice donor site probably null
R7021:Adamts15 UTSW 9 30921480 missense probably damaging 1.00
R7231:Adamts15 UTSW 9 30906158 missense probably damaging 1.00
R7290:Adamts15 UTSW 9 30902610 missense probably benign 0.05
R7390:Adamts15 UTSW 9 30911108 critical splice donor site probably null
R7798:Adamts15 UTSW 9 30904643 missense probably damaging 1.00
R7833:Adamts15 UTSW 9 30922105 missense probably benign
R7908:Adamts15 UTSW 9 30902226 missense probably benign
R8175:Adamts15 UTSW 9 30904656 missense probably damaging 1.00
R8177:Adamts15 UTSW 9 30922026 missense probably damaging 1.00
R8347:Adamts15 UTSW 9 30902550 missense probably benign 0.07
R8348:Adamts15 UTSW 9 30902550 missense probably benign 0.07
R8374:Adamts15 UTSW 9 30902706 missense probably benign 0.21
R8473:Adamts15 UTSW 9 30904789 missense probably damaging 1.00
R8680:Adamts15 UTSW 9 30911759 missense possibly damaging 0.57
R9113:Adamts15 UTSW 9 30911202 missense probably damaging 1.00
R9336:Adamts15 UTSW 9 30904789 missense probably damaging 1.00
R9381:Adamts15 UTSW 9 30902520 missense probably damaging 0.99
X0063:Adamts15 UTSW 9 30922230 missense possibly damaging 0.96
X0067:Adamts15 UTSW 9 30921582 missense probably damaging 1.00
Z1176:Adamts15 UTSW 9 30910700 missense probably damaging 1.00
Z1177:Adamts15 UTSW 9 30902491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTGGCCAACAGTGATAGTATG -3'
(R):5'- ATAGGAGACCCATAGACCTGG -3'

Sequencing Primer
(F):5'- GGCCAACAGTGATAGTATGTGCATTC -3'
(R):5'- GTCTAGGCTTCAGAGGATCCTC -3'
Posted On 2015-06-24