Mutagenetix > Incidental Mutation

Incidental Mutation 'R4326:Adamts15'

324368

Institutional Source

Beutler Lab

Gene Symbol

Adamts15

Ensembl Gene

ENSMUSG00000033453

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15

Synonyms

MMRRC Submission

041096-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4326 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30899155-30922452 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30904518 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 681 (S681G)

Ref Sequence

ENSEMBL: ENSMUSP00000067022 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065112]

AlphaFold

P59384

Predicted Effect

probably benign
Transcript: ENSMUST00000065112
AA Change: S681G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000067022
Gene: ENSMUSG00000033453
AA Change: S681G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Pep_M12B_propep	24	157	8.7e-27	PFAM
Pfam:Reprolysin_4	216	422	8.2e-7	PFAM
Pfam:Reprolysin_5	217	404	7.2e-13	PFAM
Pfam:Reprolysin	218	427	3.7e-20	PFAM
Pfam:Reprolysin_3	240	372	6.1e-10	PFAM
Blast:ACR	429	507	1e-25	BLAST
TSP1	519	571	7.85e-12	SMART
Pfam:ADAM_spacer1	683	801	7.1e-36	PFAM
TSP1	842	895	3e-8	SMART
TSP1	896	949	4.21e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217070

Meta Mutation Damage Score

0.0589

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active versicanase enzyme. This gene is located adjacent to a related ADAMTS gene (Adamts8) on chromosome 9. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	A	G	19: 7,421,226		probably benign	Het
3110043O21Rik	T	A	4: 35,225,985		probably benign	Het
Abcd3	A	G	3: 121,761,470	V616A	probably benign	Het
Abhd17a	A	G	10: 80,584,050	S241P	probably benign	Het
Arap2	A	T	5: 62,621,863	H1461Q	possibly damaging	Het
Armc3	A	G	2: 19,300,473	K681E	probably damaging	Het
Arrdc5	T	C	17: 56,294,420	E235G	possibly damaging	Het
Atxn1	T	C	13: 45,965,967		probably benign	Het
Capn13	C	A	17: 73,331,108	K433N	probably benign	Het
Ccdc113	G	A	8: 95,557,268	M323I	probably benign	Het
Cd55	A	T	1: 130,452,483	C253S	probably damaging	Het
Cyp2j8	T	A	4: 96,507,329	T20S	probably benign	Het
Dnah8	G	A	17: 30,752,092	V2707M	probably benign	Het
Erlec1	C	T	11: 30,949,972	E166K	probably benign	Het
Fastkd2	A	G	1: 63,752,357	K675E	probably benign	Het
Gid4	G	A	11: 60,417,836	V61M	possibly damaging	Het
Glt28d2	G	A	3: 85,872,086	Q27*	probably null	Het
Ipo8	A	T	6: 148,800,164		probably benign	Het
Isx	A	G	8: 74,873,656	I6V	probably benign	Het
Itsn1	A	G	16: 91,853,855		probably benign	Het
Klhl40	A	G	9: 121,778,890	D372G	probably benign	Het
Krt80	C	T	15: 101,352,308	V19M	possibly damaging	Het
Lingo2	T	A	4: 35,708,462	D506V	probably damaging	Het
Lmo7	A	T	14: 101,900,074	E504D	possibly damaging	Het
Lpcat4	G	A	2: 112,246,392	E454K	probably benign	Het
Macf1	C	T	4: 123,382,212	A4176T	probably damaging	Het
Noxo1	G	A	17: 24,698,963	R81H	probably benign	Het
Olfr479	T	C	7: 108,055,155	Y58H	probably damaging	Het
Olfr854	T	A	9: 19,567,022	M121L	possibly damaging	Het
Pafah1b1	T	C	11: 74,682,240	T333A	probably benign	Het
Pak1ip1	A	G	13: 41,004,756	D35G	possibly damaging	Het
Pak3	T	C	X: 143,733,209		probably null	Het
Pcdhb9	A	T	18: 37,401,822	S290C	probably benign	Het
Pcdhb9	G	T	18: 37,401,823	S290I	probably benign	Het
Ppp2r2d	T	A	7: 138,868,485	V25D	probably damaging	Het
Prdm15	G	T	16: 97,806,515	N709K	probably damaging	Het
Ptprs	C	A	17: 56,447,468	A191S	possibly damaging	Het
Rrs1	G	T	1: 9,546,341	R273L	possibly damaging	Het
Sin3a	T	C	9: 57,095,358	L178P	probably damaging	Het
Slc13a1	A	G	6: 24,103,479	V355A	probably benign	Het
Spen	T	G	4: 141,477,372	N1315H	unknown	Het
Ssrp1	A	G	2: 85,040,217		probably benign	Het
St7	G	A	6: 17,819,288	V64M	probably damaging	Het
Syne2	C	A	12: 75,952,742	A2304E	probably damaging	Het
Tcf25	T	A	8: 123,401,143	L622*	probably null	Het
Tmem107	G	T	11: 69,071,475		probably null	Het
Tmem62	T	A	2: 120,980,510	N156K	probably damaging	Het
Wdr90	G	T	17: 25,853,731	R884S	probably benign	Het
Zfp184	T	C	13: 21,959,902	Y593H	probably damaging	Het
Zfp934	T	G	13: 62,517,559	N312H	probably benign	Het

Other mutations in Adamts15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Adamts15	APN	9	30902053	missense	probably damaging	1.00
IGL01325:Adamts15	APN	9	30921688	missense	possibly damaging	0.86
IGL01506:Adamts15	APN	9	30922134	missense	probably benign	0.08
IGL01897:Adamts15	APN	9	30902152	missense	probably damaging	1.00
IGL02137:Adamts15	APN	9	30910660	missense	probably damaging	1.00
IGL02876:Adamts15	APN	9	30904522	missense	probably damaging	0.98
IGL02997:Adamts15	APN	9	30906057	splice site	probably benign
IGL03094:Adamts15	APN	9	30904472	splice site	probably benign
IGL03146:Adamts15	APN	9	30921567	missense	probably damaging	0.99
IGL03241:Adamts15	APN	9	30904485	missense	probably damaging	1.00
Awareness	UTSW	9	30911108	critical splice donor site	probably null
heightened	UTSW	9	30904770	missense	probably damaging	1.00
Pugsley	UTSW	9	30906158	missense	probably damaging	1.00
sparticus	UTSW	9	30910602	missense	probably benign	0.40
R0118:Adamts15	UTSW	9	30911744	missense	probably damaging	1.00
R0635:Adamts15	UTSW	9	30904770	missense	probably damaging	1.00
R0827:Adamts15	UTSW	9	30921480	missense	probably damaging	1.00
R0946:Adamts15	UTSW	9	30902197	missense	probably damaging	1.00
R1608:Adamts15	UTSW	9	30902479	missense	probably damaging	0.99
R1806:Adamts15	UTSW	9	30904815	missense	probably damaging	1.00
R1954:Adamts15	UTSW	9	30910708	missense	probably benign
R1967:Adamts15	UTSW	9	30921309	nonsense	probably null
R2009:Adamts15	UTSW	9	30922137	missense	probably benign	0.17
R2129:Adamts15	UTSW	9	30904503	missense	probably benign	0.05
R2329:Adamts15	UTSW	9	30902485	missense	probably damaging	1.00
R2991:Adamts15	UTSW	9	30921394	missense	probably benign
R3970:Adamts15	UTSW	9	30910602	missense	probably benign	0.40
R4212:Adamts15	UTSW	9	30906174	missense	probably damaging	0.99
R4329:Adamts15	UTSW	9	30904518	missense	probably benign
R4594:Adamts15	UTSW	9	30921447	missense	probably damaging	0.99
R5110:Adamts15	UTSW	9	30921444	missense	probably benign	0.01
R5120:Adamts15	UTSW	9	30921576	missense	probably damaging	1.00
R5697:Adamts15	UTSW	9	30911794	missense	probably damaging	1.00
R5901:Adamts15	UTSW	9	30902490	missense	probably damaging	1.00
R6011:Adamts15	UTSW	9	30902786	missense	probably damaging	0.98
R6020:Adamts15	UTSW	9	30902062	missense	probably benign	0.03
R6651:Adamts15	UTSW	9	30922152	missense	probably damaging	0.98
R6665:Adamts15	UTSW	9	30904479	critical splice donor site	probably null
R7021:Adamts15	UTSW	9	30921480	missense	probably damaging	1.00
R7231:Adamts15	UTSW	9	30906158	missense	probably damaging	1.00
R7290:Adamts15	UTSW	9	30902610	missense	probably benign	0.05
R7390:Adamts15	UTSW	9	30911108	critical splice donor site	probably null
R7798:Adamts15	UTSW	9	30904643	missense	probably damaging	1.00
R7833:Adamts15	UTSW	9	30922105	missense	probably benign
R7908:Adamts15	UTSW	9	30902226	missense	probably benign
R8175:Adamts15	UTSW	9	30904656	missense	probably damaging	1.00
R8177:Adamts15	UTSW	9	30922026	missense	probably damaging	1.00
R8347:Adamts15	UTSW	9	30902550	missense	probably benign	0.07
R8348:Adamts15	UTSW	9	30902550	missense	probably benign	0.07
R8374:Adamts15	UTSW	9	30902706	missense	probably benign	0.21
R8473:Adamts15	UTSW	9	30904789	missense	probably damaging	1.00
R8680:Adamts15	UTSW	9	30911759	missense	possibly damaging	0.57
R9113:Adamts15	UTSW	9	30911202	missense	probably damaging	1.00
R9336:Adamts15	UTSW	9	30904789	missense	probably damaging	1.00
R9381:Adamts15	UTSW	9	30902520	missense	probably damaging	0.99
X0063:Adamts15	UTSW	9	30922230	missense	possibly damaging	0.96
X0067:Adamts15	UTSW	9	30921582	missense	probably damaging	1.00
Z1176:Adamts15	UTSW	9	30910700	missense	probably damaging	1.00
Z1177:Adamts15	UTSW	9	30902491	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGTGGCCAACAGTGATAGTATG -3'
(R):5'- ATAGGAGACCCATAGACCTGG -3'

Sequencing Primer
(F):5'- GGCCAACAGTGATAGTATGTGCATTC -3'
(R):5'- GTCTAGGCTTCAGAGGATCCTC -3'

Posted On

2015-06-24