Incidental Mutation 'R4326:Erlec1'
ID324372
Institutional Source Beutler Lab
Gene Symbol Erlec1
Ensembl Gene ENSMUSG00000020311
Gene Nameendoplasmic reticulum lectin 1
Synonyms4933407N01Rik
MMRRC Submission 041096-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4326 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location30930774-30954335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30949972 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 166 (E166K)
Ref Sequence ENSEMBL: ENSMUSP00000072929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020551] [ENSMUST00000073192] [ENSMUST00000117883] [ENSMUST00000129593] [ENSMUST00000137306] [ENSMUST00000203878]
Predicted Effect probably benign
Transcript: ENSMUST00000020551
SMART Domains Protein: ENSMUSP00000020551
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
SOCS_box 460 502 2.1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073192
AA Change: E166K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072929
Gene: ENSMUSG00000020311
AA Change: E166K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:PRKCSH 111 199 6.6e-21 PFAM
Pfam:PRKCSH 342 421 2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117883
SMART Domains Protein: ENSMUSP00000113072
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129593
SMART Domains Protein: ENSMUSP00000129078
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
SCOP:d1c39a_ 2 52 1e-3 SMART
Pfam:PRKCSH 149 225 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137306
SMART Domains Protein: ENSMUSP00000114692
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 4.3e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143126
SMART Domains Protein: ENSMUSP00000126490
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
Pfam:PRKCSH 52 80 2.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155304
Predicted Effect probably benign
Transcript: ENSMUST00000203878
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Meta Mutation Damage Score 0.0725 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a resident endoplasmic reticulum (ER) protein that functions in N-glycan recognition. This protein is thought to be involved in ER-associated degradation via its interaction with the membrane-associated ubiquitin ligase complex. It also functions as a regulator of multiple cellular stress-response pathways in a manner that promotes metastatic cell survival. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 21. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Abcd3 A G 3: 121,761,470 V616A probably benign Het
Abhd17a A G 10: 80,584,050 S241P probably benign Het
Adamts15 T C 9: 30,904,518 S681G probably benign Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Armc3 A G 2: 19,300,473 K681E probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atxn1 T C 13: 45,965,967 probably benign Het
Capn13 C A 17: 73,331,108 K433N probably benign Het
Ccdc113 G A 8: 95,557,268 M323I probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Dnah8 G A 17: 30,752,092 V2707M probably benign Het
Fastkd2 A G 1: 63,752,357 K675E probably benign Het
Gid4 G A 11: 60,417,836 V61M possibly damaging Het
Glt28d2 G A 3: 85,872,086 Q27* probably null Het
Ipo8 A T 6: 148,800,164 probably benign Het
Isx A G 8: 74,873,656 I6V probably benign Het
Itsn1 A G 16: 91,853,855 probably benign Het
Klhl40 A G 9: 121,778,890 D372G probably benign Het
Krt80 C T 15: 101,352,308 V19M possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Lmo7 A T 14: 101,900,074 E504D possibly damaging Het
Lpcat4 G A 2: 112,246,392 E454K probably benign Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
Noxo1 G A 17: 24,698,963 R81H probably benign Het
Olfr479 T C 7: 108,055,155 Y58H probably damaging Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Pak1ip1 A G 13: 41,004,756 D35G possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Ppp2r2d T A 7: 138,868,485 V25D probably damaging Het
Prdm15 G T 16: 97,806,515 N709K probably damaging Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rrs1 G T 1: 9,546,341 R273L possibly damaging Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
Spen T G 4: 141,477,372 N1315H unknown Het
Ssrp1 A G 2: 85,040,217 probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Syne2 C A 12: 75,952,742 A2304E probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem62 T A 2: 120,980,510 N156K probably damaging Het
Wdr90 G T 17: 25,853,731 R884S probably benign Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in Erlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Erlec1 APN 11 30948510 missense possibly damaging 0.84
IGL00537:Erlec1 APN 11 30939591 missense probably benign 0.04
IGL00766:Erlec1 APN 11 30950623 nonsense probably null
IGL01760:Erlec1 APN 11 30934731 missense probably benign 0.34
IGL02505:Erlec1 APN 11 30950767 missense probably damaging 1.00
IGL02633:Erlec1 APN 11 30948430 nonsense probably null
R0674:Erlec1 UTSW 11 30935073 intron probably benign
R1211:Erlec1 UTSW 11 30948298 critical splice donor site probably null
R1974:Erlec1 UTSW 11 30939604 missense possibly damaging 0.83
R4328:Erlec1 UTSW 11 30949972 missense probably benign
R4392:Erlec1 UTSW 11 30943697 critical splice donor site probably null
R4641:Erlec1 UTSW 11 30948442 nonsense probably null
R4697:Erlec1 UTSW 11 30952640 missense probably benign 0.27
R4917:Erlec1 UTSW 11 30934710 missense possibly damaging 0.56
R5486:Erlec1 UTSW 11 30935047 missense probably damaging 0.98
R5735:Erlec1 UTSW 11 30950591 missense probably benign 0.00
R5775:Erlec1 UTSW 11 30943848 missense probably benign 0.11
R6475:Erlec1 UTSW 11 30948442 nonsense probably null
R7027:Erlec1 UTSW 11 30950790 missense probably damaging 1.00
R7235:Erlec1 UTSW 11 30950751 missense possibly damaging 0.91
R7440:Erlec1 UTSW 11 30950818 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCTAGACACTGTTCTATTTCTGGG -3'
(R):5'- TGCTGGCTCCAATACCCAAC -3'

Sequencing Primer
(F):5'- AATATGTGAGCCATCGTGCC -3'
(R):5'- TGGCTCCAATACCCAACAACCC -3'
Posted On2015-06-24