Incidental Mutation 'R4326:Zfp184'
ID 324377
Institutional Source Beutler Lab
Gene Symbol Zfp184
Ensembl Gene ENSMUSG00000006720
Gene Name zinc finger protein 184 (Kruppel-like)
Synonyms
MMRRC Submission 041096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock # R4326 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 21945094-21960779 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21959902 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 593 (Y593H)
Ref Sequence ENSEMBL: ENSMUSP00000135173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006903] [ENSMUST00000102978] [ENSMUST00000176511] [ENSMUST00000176580]
AlphaFold Q7TSH9
Predicted Effect probably damaging
Transcript: ENSMUST00000006903
AA Change: Y593H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006903
Gene: ENSMUSG00000006720
AA Change: Y593H

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102978
AA Change: Y593H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100043
Gene: ENSMUSG00000006720
AA Change: Y593H

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176003
Predicted Effect probably damaging
Transcript: ENSMUST00000176511
AA Change: Y593H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135173
Gene: ENSMUSG00000006720
AA Change: Y593H

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176580
SMART Domains Protein: ENSMUSP00000135404
Gene: ENSMUSG00000006720

DomainStartEndE-ValueType
KRAB 28 84 1.96e-17 SMART
Meta Mutation Damage Score 0.6692 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to be a Kruppel C2H2-type zinc-finger protein family member. Sequence analysis predicts that the protein contains two Kruppel associated box (KRAB) boxes in the N-terminus and highly conserved zinc finger motifs at the C-terminus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Abcd3 A G 3: 121,761,470 V616A probably benign Het
Abhd17a A G 10: 80,584,050 S241P probably benign Het
Adamts15 T C 9: 30,904,518 S681G probably benign Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Armc3 A G 2: 19,300,473 K681E probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atxn1 T C 13: 45,965,967 probably benign Het
Capn13 C A 17: 73,331,108 K433N probably benign Het
Ccdc113 G A 8: 95,557,268 M323I probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Dnah8 G A 17: 30,752,092 V2707M probably benign Het
Erlec1 C T 11: 30,949,972 E166K probably benign Het
Fastkd2 A G 1: 63,752,357 K675E probably benign Het
Gid4 G A 11: 60,417,836 V61M possibly damaging Het
Glt28d2 G A 3: 85,872,086 Q27* probably null Het
Ipo8 A T 6: 148,800,164 probably benign Het
Isx A G 8: 74,873,656 I6V probably benign Het
Itsn1 A G 16: 91,853,855 probably benign Het
Klhl40 A G 9: 121,778,890 D372G probably benign Het
Krt80 C T 15: 101,352,308 V19M possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Lmo7 A T 14: 101,900,074 E504D possibly damaging Het
Lpcat4 G A 2: 112,246,392 E454K probably benign Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
Noxo1 G A 17: 24,698,963 R81H probably benign Het
Olfr479 T C 7: 108,055,155 Y58H probably damaging Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Pak1ip1 A G 13: 41,004,756 D35G possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Ppp2r2d T A 7: 138,868,485 V25D probably damaging Het
Prdm15 G T 16: 97,806,515 N709K probably damaging Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rrs1 G T 1: 9,546,341 R273L possibly damaging Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
Spen T G 4: 141,477,372 N1315H unknown Het
Ssrp1 A G 2: 85,040,217 probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Syne2 C A 12: 75,952,742 A2304E probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem62 T A 2: 120,980,510 N156K probably damaging Het
Wdr90 G T 17: 25,853,731 R884S probably benign Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in Zfp184
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Zfp184 APN 13 21950225 splice site probably benign
R0393:Zfp184 UTSW 13 21947082 splice site probably benign
R0636:Zfp184 UTSW 13 21949749 missense probably damaging 1.00
R1657:Zfp184 UTSW 13 21959273 missense probably damaging 1.00
R1718:Zfp184 UTSW 13 21959272 missense possibly damaging 0.76
R4237:Zfp184 UTSW 13 21958778 missense probably damaging 1.00
R4327:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4328:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4877:Zfp184 UTSW 13 21960328 missense possibly damaging 0.92
R4941:Zfp184 UTSW 13 21949721 missense probably damaging 1.00
R5014:Zfp184 UTSW 13 21958424 missense probably benign 0.37
R5054:Zfp184 UTSW 13 21959282 missense possibly damaging 0.74
R5105:Zfp184 UTSW 13 21959629 missense possibly damaging 0.58
R5216:Zfp184 UTSW 13 21950236 missense probably damaging 1.00
R5379:Zfp184 UTSW 13 21959881 missense probably damaging 1.00
R5387:Zfp184 UTSW 13 21949640 intron probably benign
R5490:Zfp184 UTSW 13 21958577 missense probably benign 0.40
R6220:Zfp184 UTSW 13 21960207 missense probably damaging 1.00
R6752:Zfp184 UTSW 13 21959408 missense probably damaging 0.99
R7088:Zfp184 UTSW 13 21959992 missense probably damaging 1.00
R7653:Zfp184 UTSW 13 21959717 missense probably damaging 1.00
R7980:Zfp184 UTSW 13 21960206 missense probably damaging 1.00
R8056:Zfp184 UTSW 13 21958838 missense probably damaging 1.00
R8214:Zfp184 UTSW 13 21958825 missense probably damaging 1.00
R8235:Zfp184 UTSW 13 21959883 missense probably damaging 1.00
R8748:Zfp184 UTSW 13 21960047 missense probably benign 0.00
R8891:Zfp184 UTSW 13 21959342 missense probably damaging 1.00
R9024:Zfp184 UTSW 13 21958958 missense probably damaging 1.00
R9082:Zfp184 UTSW 13 21959466 missense probably damaging 1.00
R9344:Zfp184 UTSW 13 21960241 missense probably damaging 1.00
R9436:Zfp184 UTSW 13 21949728 missense probably benign 0.03
R9568:Zfp184 UTSW 13 21958727 missense probably benign 0.25
R9664:Zfp184 UTSW 13 21959926 missense probably benign
R9709:Zfp184 UTSW 13 21959495 missense possibly damaging 0.67
X0057:Zfp184 UTSW 13 21959548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAGTTCATCTCTTGCTAAGC -3'
(R):5'- TGAGAGCAGAGTGACACTGG -3'

Sequencing Primer
(F):5'- CTGGAGAGAAGCCTTATCAATGTC -3'
(R):5'- GACACTGGAAGGCTTTTTCACAGTC -3'
Posted On 2015-06-24