Incidental Mutation 'R4326:Zfp934'
ID324380
Institutional Source Beutler Lab
Gene Symbol Zfp934
Ensembl Gene ENSMUSG00000074865
Gene Namezinc finger protein 934
Synonyms
MMRRC Submission 041096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R4326 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location62479827-62571199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 62517559 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 312 (N312H)
Ref Sequence ENSEMBL: ENSMUSP00000080837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076195] [ENSMUST00000082203] [ENSMUST00000101547] [ENSMUST00000220648] [ENSMUST00000221250] [ENSMUST00000222429] [ENSMUST00000222746] [ENSMUST00000222852]
Predicted Effect probably benign
Transcript: ENSMUST00000076195
SMART Domains Protein: ENSMUSP00000075552
Gene: ENSMUSG00000055228

DomainStartEndE-ValueType
KRAB 4 66 8.26e-16 SMART
ZnF_C2H2 133 155 2.09e-3 SMART
ZnF_C2H2 161 183 1.4e-4 SMART
ZnF_C2H2 189 211 2.57e-3 SMART
ZnF_C2H2 217 239 5.5e-3 SMART
ZnF_C2H2 245 267 7.26e-3 SMART
ZnF_C2H2 273 295 1.4e-4 SMART
ZnF_C2H2 301 323 8.6e-5 SMART
ZnF_C2H2 329 351 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082203
AA Change: N312H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000080837
Gene: ENSMUSG00000074865
AA Change: N312H

DomainStartEndE-ValueType
Blast:KRAB 1 34 3e-16 BLAST
ZnF_C2H2 101 123 1.04e-3 SMART
ZnF_C2H2 129 149 1.68e1 SMART
ZnF_C2H2 157 179 2.75e-3 SMART
ZnF_C2H2 185 207 1.98e-4 SMART
ZnF_C2H2 213 235 3.21e-4 SMART
ZnF_C2H2 241 263 3.44e-4 SMART
ZnF_C2H2 269 292 4.98e-1 SMART
ZnF_C2H2 298 320 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101547
AA Change: N455H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099083
Gene: ENSMUSG00000074865
AA Change: N455H

DomainStartEndE-ValueType
KRAB 3 65 5.01e-15 SMART
ZnF_C2H2 132 154 1.04e-3 SMART
ZnF_C2H2 160 180 1.68e1 SMART
ZnF_C2H2 188 210 2.75e-3 SMART
ZnF_C2H2 216 238 1.98e-4 SMART
ZnF_C2H2 244 266 3.21e-4 SMART
ZnF_C2H2 272 294 3.44e-4 SMART
ZnF_C2H2 300 322 2.27e-4 SMART
ZnF_C2H2 328 350 3.44e-4 SMART
ZnF_C2H2 356 378 9.22e-5 SMART
ZnF_C2H2 384 406 2.43e-4 SMART
ZnF_C2H2 412 434 1.3e-4 SMART
ZnF_C2H2 440 462 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220648
AA Change: N423H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221494
Predicted Effect probably benign
Transcript: ENSMUST00000222429
Predicted Effect probably benign
Transcript: ENSMUST00000222746
Predicted Effect probably benign
Transcript: ENSMUST00000222852
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Abcd3 A G 3: 121,761,470 V616A probably benign Het
Abhd17a A G 10: 80,584,050 S241P probably benign Het
Adamts15 T C 9: 30,904,518 S681G probably benign Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Armc3 A G 2: 19,300,473 K681E probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atxn1 T C 13: 45,965,967 probably benign Het
Capn13 C A 17: 73,331,108 K433N probably benign Het
Ccdc113 G A 8: 95,557,268 M323I probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Dnah8 G A 17: 30,752,092 V2707M probably benign Het
Erlec1 C T 11: 30,949,972 E166K probably benign Het
Fastkd2 A G 1: 63,752,357 K675E probably benign Het
Gid4 G A 11: 60,417,836 V61M possibly damaging Het
Glt28d2 G A 3: 85,872,086 Q27* probably null Het
Ipo8 A T 6: 148,800,164 probably benign Het
Isx A G 8: 74,873,656 I6V probably benign Het
Itsn1 A G 16: 91,853,855 probably benign Het
Klhl40 A G 9: 121,778,890 D372G probably benign Het
Krt80 C T 15: 101,352,308 V19M possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Lmo7 A T 14: 101,900,074 E504D possibly damaging Het
Lpcat4 G A 2: 112,246,392 E454K probably benign Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
Noxo1 G A 17: 24,698,963 R81H probably benign Het
Olfr479 T C 7: 108,055,155 Y58H probably damaging Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Pak1ip1 A G 13: 41,004,756 D35G possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Ppp2r2d T A 7: 138,868,485 V25D probably damaging Het
Prdm15 G T 16: 97,806,515 N709K probably damaging Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rrs1 G T 1: 9,546,341 R273L possibly damaging Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
Spen T G 4: 141,477,372 N1315H unknown Het
Ssrp1 A G 2: 85,040,217 probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Syne2 C A 12: 75,952,742 A2304E probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem62 T A 2: 120,980,510 N156K probably damaging Het
Wdr90 G T 17: 25,853,731 R884S probably benign Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Other mutations in Zfp934
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1915:Zfp934 UTSW 13 62517955 missense probably damaging 1.00
R1957:Zfp934 UTSW 13 62518294 missense possibly damaging 0.83
R2113:Zfp934 UTSW 13 62518693 missense probably damaging 0.98
R2145:Zfp934 UTSW 13 62517834 missense probably damaging 1.00
R3732:Zfp934 UTSW 13 62517785 missense probably damaging 1.00
R3797:Zfp934 UTSW 13 62517888 missense probably benign
R4327:Zfp934 UTSW 13 62517559 missense probably benign 0.01
R4909:Zfp934 UTSW 13 62517954 missense probably damaging 1.00
R5236:Zfp934 UTSW 13 62517713 missense probably damaging 1.00
R5237:Zfp934 UTSW 13 62517838 missense probably damaging 1.00
R6305:Zfp934 UTSW 13 62518556 missense probably damaging 0.99
R6729:Zfp934 UTSW 13 62492932 missense probably damaging 1.00
R7072:Zfp934 UTSW 13 62520525 missense probably damaging 0.99
R7186:Zfp934 UTSW 13 62492390 missense probably benign 0.12
R7235:Zfp934 UTSW 13 62518150 missense
R7453:Zfp934 UTSW 13 62518703 missense probably benign 0.40
R7552:Zfp934 UTSW 13 62492891 missense probably damaging 1.00
R7589:Zfp934 UTSW 13 62518316 missense
R7624:Zfp934 UTSW 13 62518524 missense probably benign 0.27
R7651:Zfp934 UTSW 13 62518513 missense probably benign
R7780:Zfp934 UTSW 13 62518544 missense possibly damaging 0.92
R7857:Zfp934 UTSW 13 62517547 missense
R7891:Zfp934 UTSW 13 62520189 missense probably benign 0.35
R7974:Zfp934 UTSW 13 62520189 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CACAATCCAATTCCTTCGTAGC -3'
(R):5'- CAGTGTGATAAAGCCTTTTCTGAG -3'

Sequencing Primer
(F):5'- ACACACACTGAATAAACTTGTAAGG -3'
(R):5'- AGCCTTTTCTGAGAAATGTAGTCTCC -3'
Posted On2015-06-24