Incidental Mutation 'R4326:Noxo1'
ID324385
Institutional Source Beutler Lab
Gene Symbol Noxo1
Ensembl Gene ENSMUSG00000019320
Gene NameNADPH oxidase organizer 1
Synonyms2310034C04Rik
MMRRC Submission 041096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4326 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24696234-24700529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24698963 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 81 (R81H)
Ref Sequence ENSEMBL: ENSMUSP00000019464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019464] [ENSMUST00000046839] [ENSMUST00000126319]
Predicted Effect probably benign
Transcript: ENSMUST00000019464
AA Change: R81H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000019464
Gene: ENSMUSG00000019320
AA Change: R81H

DomainStartEndE-ValueType
PX 6 122 1.36e-2 SMART
SH3 160 218 1.55e0 SMART
SH3 234 289 1.8e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046534
Predicted Effect probably benign
Transcript: ENSMUST00000046839
SMART Domains Protein: ENSMUSP00000049186
Gene: ENSMUSG00000040888

DomainStartEndE-ValueType
low complexity region 33 47 N/A INTRINSIC
low complexity region 48 54 N/A INTRINSIC
Pfam:Evr1_Alr 97 189 2.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124864
Predicted Effect probably benign
Transcript: ENSMUST00000126319
SMART Domains Protein: ENSMUSP00000120911
Gene: ENSMUSG00000040688

DomainStartEndE-ValueType
WD40 54 94 3.08e0 SMART
WD40 97 137 2.38e-6 SMART
WD40 140 181 3.85e-1 SMART
WD40 184 223 6.94e-8 SMART
WD40 237 275 7.36e1 SMART
WD40 278 320 3.07e1 SMART
WD40 323 363 1.78e0 SMART
WD40 365 404 1.17e-5 SMART
WD40 410 450 8.16e-5 SMART
WD40 468 507 5.18e-7 SMART
WD40 510 549 8.1e-9 SMART
WD40 552 591 8.55e-8 SMART
WD40 594 633 2.93e-6 SMART
low complexity region 637 650 N/A INTRINSIC
Pfam:Utp13 654 788 3.7e-43 PFAM
low complexity region 792 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126342
Predicted Effect probably benign
Transcript: ENSMUST00000130633
SMART Domains Protein: ENSMUSP00000117818
Gene: ENSMUSG00000040688

DomainStartEndE-ValueType
WD40 2 38 8.75e-5 SMART
WD40 41 80 8.1e-9 SMART
WD40 90 129 9.52e-6 SMART
WD40 132 171 2.93e-6 SMART
low complexity region 175 188 N/A INTRINSIC
Pfam:Utp13 192 299 1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150313
Meta Mutation Damage Score 0.0900 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an NADPH oxidase (NOX) organizer, which positively regulates NOX1 and NOX3. The protein contains a PX domain and two SH3 domains. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mutations at this locus affect the inner ear and result in vestibular related movement anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Abcd3 A G 3: 121,761,470 V616A probably benign Het
Abhd17a A G 10: 80,584,050 S241P probably benign Het
Adamts15 T C 9: 30,904,518 S681G probably benign Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Armc3 A G 2: 19,300,473 K681E probably damaging Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atxn1 T C 13: 45,965,967 probably benign Het
Capn13 C A 17: 73,331,108 K433N probably benign Het
Ccdc113 G A 8: 95,557,268 M323I probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Dnah8 G A 17: 30,752,092 V2707M probably benign Het
Erlec1 C T 11: 30,949,972 E166K probably benign Het
Fastkd2 A G 1: 63,752,357 K675E probably benign Het
Gid4 G A 11: 60,417,836 V61M possibly damaging Het
Glt28d2 G A 3: 85,872,086 Q27* probably null Het
Ipo8 A T 6: 148,800,164 probably benign Het
Isx A G 8: 74,873,656 I6V probably benign Het
Itsn1 A G 16: 91,853,855 probably benign Het
Klhl40 A G 9: 121,778,890 D372G probably benign Het
Krt80 C T 15: 101,352,308 V19M possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Lmo7 A T 14: 101,900,074 E504D possibly damaging Het
Lpcat4 G A 2: 112,246,392 E454K probably benign Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
Olfr479 T C 7: 108,055,155 Y58H probably damaging Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Pak1ip1 A G 13: 41,004,756 D35G possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Ppp2r2d T A 7: 138,868,485 V25D probably damaging Het
Prdm15 G T 16: 97,806,515 N709K probably damaging Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rrs1 G T 1: 9,546,341 R273L possibly damaging Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
Spen T G 4: 141,477,372 N1315H unknown Het
Ssrp1 A G 2: 85,040,217 probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Syne2 C A 12: 75,952,742 A2304E probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem62 T A 2: 120,980,510 N156K probably damaging Het
Wdr90 G T 17: 25,853,731 R884S probably benign Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in Noxo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Noxo1 APN 17 24698936 unclassified probably benign
IGL02441:Noxo1 APN 17 24699056 missense probably damaging 0.97
IGL02549:Noxo1 APN 17 24700171 missense probably damaging 1.00
IGL02881:Noxo1 APN 17 24699435 missense probably damaging 1.00
IGL02881:Noxo1 APN 17 24699436 missense probably damaging 1.00
fabregas UTSW 17 24699357 missense probably damaging 1.00
R0276:Noxo1 UTSW 17 24700162 splice site probably null
R5080:Noxo1 UTSW 17 24699357 missense probably damaging 1.00
R5487:Noxo1 UTSW 17 24698317 unclassified probably benign
R5854:Noxo1 UTSW 17 24698542 missense probably damaging 1.00
R6119:Noxo1 UTSW 17 24696571 unclassified probably benign
R7889:Noxo1 UTSW 17 24699382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTCTCTCCATCTCAAAGAC -3'
(R):5'- CAACAAGTGCATTGGCTGGG -3'

Sequencing Primer
(F):5'- GTTCTCTCCATCTCAAAGACTAACAC -3'
(R):5'- GAGCAGGGTGAAGGTTAGTCAC -3'
Posted On2015-06-24