Incidental Mutation 'R4327:1700019A02Rik'
ID324393
Institutional Source Beutler Lab
Gene Symbol 1700019A02Rik
Ensembl Gene ENSMUSG00000060715
Gene NameRIKEN cDNA 1700019A02 gene
Synonyms
MMRRC Submission 041097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R4327 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location53158577-53187636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53182505 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 55 (D55G)
Ref Sequence ENSEMBL: ENSMUSP00000139938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072235] [ENSMUST00000190748]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072235
AA Change: D55G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072089
Gene: ENSMUSG00000060715
AA Change: D55G

DomainStartEndE-ValueType
coiled coil region 38 68 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190748
AA Change: D55G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139938
Gene: ENSMUSG00000060715
AA Change: D55G

DomainStartEndE-ValueType
coiled coil region 38 68 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,225,985 probably benign Het
Alcam T C 16: 52,253,216 N549S possibly damaging Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Arhgef12 C A 9: 42,975,229 E1152* probably null Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atp1a3 A G 7: 24,987,631 probably benign Het
Bcl2l1 A G 2: 152,782,179 V223A probably benign Het
Cela3b G T 4: 137,423,931 A137E probably benign Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Col16a1 T C 4: 130,094,551 probably null Het
Ctcfl G A 2: 173,113,506 probably benign Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Fastkd2 A G 1: 63,752,357 K675E probably benign Het
Fsip2 A T 2: 82,987,059 I4379F probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hmgxb3 A T 18: 61,167,539 M155K probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kcnn1 A T 8: 70,852,663 V301E probably damaging Het
Kcnq4 T C 4: 120,711,364 E385G probably benign Het
Klhl28 G A 12: 64,950,178 A463V probably damaging Het
Lhb A G 7: 45,420,959 R3G possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
March6 C T 15: 31,498,741 E137K probably benign Het
Med12l T C 3: 59,265,267 S1813P probably benign Het
Mpp3 T C 11: 102,023,511 probably benign Het
Muc2 A C 7: 141,695,334 S479R probably damaging Het
Olfr1145 G T 2: 87,810,152 V111L probably benign Het
Olfr31 T A 14: 14,328,193 F27L probably damaging Het
Olfr664 G A 7: 104,733,626 T246I probably damaging Het
Olfr743 T A 14: 50,533,514 I34N probably benign Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Palm G A 10: 79,807,686 G83S probably benign Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Pdgfrb A T 18: 61,071,720 I551F possibly damaging Het
Pex26 A T 6: 121,187,414 E172V probably damaging Het
Pitrm1 A G 13: 6,579,773 probably benign Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rdm1 T A 11: 101,630,908 V92E probably damaging Het
Scn7a A G 2: 66,737,471 F260L probably damaging Het
Serpinb3a T A 1: 107,051,770 M1L probably damaging Het
Sh3d19 T C 3: 86,123,713 I728T probably benign Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tiam1 A G 16: 89,855,891 V781A possibly damaging Het
Tigd2 C A 6: 59,210,577 T143K probably benign Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem161b G A 13: 84,251,240 G5D probably damaging Het
Tonsl G A 15: 76,639,716 A28V probably benign Het
Treml4 T C 17: 48,274,389 Y222H probably damaging Het
Trp53bp1 A T 2: 121,256,650 V175D probably damaging Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp286 A G 11: 62,780,018 C410R probably damaging Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in 1700019A02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01728:1700019A02Rik APN 1 53182509 missense probably benign 0.03
IGL02249:1700019A02Rik APN 1 53185272 nonsense probably null
IGL02727:1700019A02Rik APN 1 53187565 missense probably benign 0.00
IGL02970:1700019A02Rik APN 1 53187589 missense probably damaging 0.99
IGL03402:1700019A02Rik APN 1 53177813 missense probably benign 0.00
R1557:1700019A02Rik UTSW 1 53181866 missense possibly damaging 0.81
R1955:1700019A02Rik UTSW 1 53163241 missense probably benign 0.09
R4030:1700019A02Rik UTSW 1 53182509 missense probably benign 0.03
R4060:1700019A02Rik UTSW 1 53158769 missense probably damaging 0.97
R4061:1700019A02Rik UTSW 1 53158769 missense probably damaging 0.97
R4062:1700019A02Rik UTSW 1 53158769 missense probably damaging 0.97
R6018:1700019A02Rik UTSW 1 53163246 critical splice acceptor site probably null
R7490:1700019A02Rik UTSW 1 53163230 missense possibly damaging 0.90
R7715:1700019A02Rik UTSW 1 53182500 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGACAAGTATCAGAATCAGGGC -3'
(R):5'- TGCAGACTCATTGGGAACTGAATG -3'

Sequencing Primer
(F):5'- GGGCAAATTTATATAAACACCAAGC -3'
(R):5'- CTTGGGTGTGAAGCCAAAGC -3'
Posted On2015-06-24