Incidental Mutation 'R4327:Fastkd2'
ID324394
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene NameFAST kinase domains 2
Synonyms2810421I24Rik
MMRRC Submission 041097-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4327 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location63730614-63754655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63752357 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 675 (K675E)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027102] [ENSMUST00000027103]
Predicted Effect probably benign
Transcript: ENSMUST00000027102
Predicted Effect probably benign
Transcript: ENSMUST00000027103
AA Change: K675E

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: K675E

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134454
Meta Mutation Damage Score 0.3333 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,182,505 D55G possibly damaging Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Alcam T C 16: 52,253,216 N549S possibly damaging Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Arhgef12 C A 9: 42,975,229 E1152* probably null Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atp1a3 A G 7: 24,987,631 probably benign Het
Bcl2l1 A G 2: 152,782,179 V223A probably benign Het
Cela3b G T 4: 137,423,931 A137E probably benign Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Col16a1 T C 4: 130,094,551 probably null Het
Ctcfl G A 2: 173,113,506 probably benign Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Fsip2 A T 2: 82,987,059 I4379F probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hmgxb3 A T 18: 61,167,539 M155K probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kcnn1 A T 8: 70,852,663 V301E probably damaging Het
Kcnq4 T C 4: 120,711,364 E385G probably benign Het
Klhl28 G A 12: 64,950,178 A463V probably damaging Het
Lhb A G 7: 45,420,959 R3G possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
March6 C T 15: 31,498,741 E137K probably benign Het
Med12l T C 3: 59,265,267 S1813P probably benign Het
Mpp3 T C 11: 102,023,511 probably benign Het
Muc2 A C 7: 141,695,334 S479R probably damaging Het
Olfr1145 G T 2: 87,810,152 V111L probably benign Het
Olfr31 T A 14: 14,328,193 F27L probably damaging Het
Olfr664 G A 7: 104,733,626 T246I probably damaging Het
Olfr743 T A 14: 50,533,514 I34N probably benign Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Palm G A 10: 79,807,686 G83S probably benign Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Pdgfrb A T 18: 61,071,720 I551F possibly damaging Het
Pex26 A T 6: 121,187,414 E172V probably damaging Het
Pitrm1 A G 13: 6,579,773 probably benign Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rdm1 T A 11: 101,630,908 V92E probably damaging Het
Scn7a A G 2: 66,737,471 F260L probably damaging Het
Serpinb3a T A 1: 107,051,770 M1L probably damaging Het
Sh3d19 T C 3: 86,123,713 I728T probably benign Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tiam1 A G 16: 89,855,891 V781A possibly damaging Het
Tigd2 C A 6: 59,210,577 T143K probably benign Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem161b G A 13: 84,251,240 G5D probably damaging Het
Tonsl G A 15: 76,639,716 A28V probably benign Het
Treml4 T C 17: 48,274,389 Y222H probably damaging Het
Trp53bp1 A T 2: 121,256,650 V175D probably damaging Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp286 A G 11: 62,780,018 C410R probably damaging Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63737771 splice site probably benign
IGL01890:Fastkd2 APN 1 63732161 missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63747999 missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63737924 splice site probably benign
IGL03208:Fastkd2 APN 1 63739206 missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63732028 missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63752400 missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63737811 missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63752340 missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63747955 splice site probably benign
R1468:Fastkd2 UTSW 1 63732226 unclassified probably benign
R1579:Fastkd2 UTSW 1 63745887 missense probably null 0.00
R1729:Fastkd2 UTSW 1 63751300 nonsense probably null
R3937:Fastkd2 UTSW 1 63737836 missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63735809 intron probably benign
R4473:Fastkd2 UTSW 1 63731674 missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63745886 missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63749896 intron probably benign
R5176:Fastkd2 UTSW 1 63731439 unclassified probably benign
R5478:Fastkd2 UTSW 1 63739186 missense probably benign 0.13
R5619:Fastkd2 UTSW 1 63739310 missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63731794 missense possibly damaging 0.75
R7038:Fastkd2 UTSW 1 63731873 missense possibly damaging 0.79
R7049:Fastkd2 UTSW 1 63731850 missense probably benign 0.04
R7510:Fastkd2 UTSW 1 63737789 missense possibly damaging 0.83
R7810:Fastkd2 UTSW 1 63731692 missense possibly damaging 0.61
R7889:Fastkd2 UTSW 1 63735460 splice site probably null
R8263:Fastkd2 UTSW 1 63731809 missense probably benign 0.03
R8271:Fastkd2 UTSW 1 63748024 missense probably benign 0.26
R8321:Fastkd2 UTSW 1 63747979 missense probably benign 0.00
R8468:Fastkd2 UTSW 1 63731764 missense probably benign 0.06
R8767:Fastkd2 UTSW 1 63735921 missense probably benign 0.00
Z1177:Fastkd2 UTSW 1 63734836 critical splice donor site probably null
Z1177:Fastkd2 UTSW 1 63734837 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGAATATGAACATGTGCATGGTG -3'
(R):5'- CCAGTGTGTTCCAAAATACCAATG -3'

Sequencing Primer
(F):5'- GAACATGTGCATGGTGATATTTAATC -3'
(R):5'- GTGTGTTCCAAAATACCAATGACAAC -3'
Posted On2015-06-24