Incidental Mutation 'R4327:Olfr1145'
ID324399
Institutional Source Beutler Lab
Gene Symbol Olfr1145
Ensembl Gene ENSMUSG00000068814
Gene Nameolfactory receptor 1145
SynonymsGA_x6K02T2Q125-49311440-49312384, MOR264-19
MMRRC Submission 041097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4327 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87809822-87810799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87810152 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 111 (V111L)
Ref Sequence ENSEMBL: ENSMUSP00000088209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079711] [ENSMUST00000090707]
Predicted Effect probably benign
Transcript: ENSMUST00000079711
AA Change: V100L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078649
Gene: ENSMUSG00000068814
AA Change: V100L

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.4e-52 PFAM
Pfam:7tm_1 47 296 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090707
AA Change: V111L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088209
Gene: ENSMUSG00000068814
AA Change: V111L

DomainStartEndE-ValueType
transmembrane domain 21 38 N/A INTRINSIC
Pfam:7tm_4 48 325 6.2e-58 PFAM
Pfam:7tm_1 58 307 1.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118227
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,182,505 D55G possibly damaging Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Alcam T C 16: 52,253,216 N549S possibly damaging Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Arhgef12 C A 9: 42,975,229 E1152* probably null Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atp1a3 A G 7: 24,987,631 probably benign Het
Bcl2l1 A G 2: 152,782,179 V223A probably benign Het
Cela3b G T 4: 137,423,931 A137E probably benign Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Col16a1 T C 4: 130,094,551 probably null Het
Ctcfl G A 2: 173,113,506 probably benign Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Fastkd2 A G 1: 63,752,357 K675E probably benign Het
Fsip2 A T 2: 82,987,059 I4379F probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hmgxb3 A T 18: 61,167,539 M155K probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kcnn1 A T 8: 70,852,663 V301E probably damaging Het
Kcnq4 T C 4: 120,711,364 E385G probably benign Het
Klhl28 G A 12: 64,950,178 A463V probably damaging Het
Lhb A G 7: 45,420,959 R3G possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
March6 C T 15: 31,498,741 E137K probably benign Het
Med12l T C 3: 59,265,267 S1813P probably benign Het
Mpp3 T C 11: 102,023,511 probably benign Het
Muc2 A C 7: 141,695,334 S479R probably damaging Het
Olfr31 T A 14: 14,328,193 F27L probably damaging Het
Olfr664 G A 7: 104,733,626 T246I probably damaging Het
Olfr743 T A 14: 50,533,514 I34N probably benign Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Palm G A 10: 79,807,686 G83S probably benign Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Pdgfrb A T 18: 61,071,720 I551F possibly damaging Het
Pex26 A T 6: 121,187,414 E172V probably damaging Het
Pitrm1 A G 13: 6,579,773 probably benign Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rdm1 T A 11: 101,630,908 V92E probably damaging Het
Scn7a A G 2: 66,737,471 F260L probably damaging Het
Serpinb3a T A 1: 107,051,770 M1L probably damaging Het
Sh3d19 T C 3: 86,123,713 I728T probably benign Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tiam1 A G 16: 89,855,891 V781A possibly damaging Het
Tigd2 C A 6: 59,210,577 T143K probably benign Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem161b G A 13: 84,251,240 G5D probably damaging Het
Tonsl G A 15: 76,639,716 A28V probably benign Het
Treml4 T C 17: 48,274,389 Y222H probably damaging Het
Trp53bp1 A T 2: 121,256,650 V175D probably damaging Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp286 A G 11: 62,780,018 C410R probably damaging Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in Olfr1145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Olfr1145 APN 2 87810648 missense probably damaging 1.00
IGL01335:Olfr1145 APN 2 87810446 missense probably damaging 1.00
PIT4418001:Olfr1145 UTSW 2 87810594 missense probably damaging 0.99
R1512:Olfr1145 UTSW 2 87810644 missense probably benign 0.23
R1700:Olfr1145 UTSW 2 87810768 missense probably benign
R2127:Olfr1145 UTSW 2 87810341 missense probably benign 0.09
R2162:Olfr1145 UTSW 2 87810360 missense probably damaging 1.00
R3707:Olfr1145 UTSW 2 87810176 missense probably damaging 1.00
R4422:Olfr1145 UTSW 2 87810645 missense probably damaging 0.97
R4854:Olfr1145 UTSW 2 87810590 missense probably damaging 1.00
R5234:Olfr1145 UTSW 2 87810768 missense probably benign
R5858:Olfr1145 UTSW 2 87810641 missense probably benign 0.22
R6229:Olfr1145 UTSW 2 87810087 missense probably damaging 1.00
R6991:Olfr1145 UTSW 2 87810443 missense possibly damaging 0.76
R7007:Olfr1145 UTSW 2 87809886 missense probably damaging 1.00
R7027:Olfr1145 UTSW 2 87810716 missense possibly damaging 0.90
R7260:Olfr1145 UTSW 2 87810387 missense probably damaging 0.98
R7624:Olfr1145 UTSW 2 87810339 missense probably damaging 1.00
R7794:Olfr1145 UTSW 2 87810474 missense probably damaging 0.97
R8029:Olfr1145 UTSW 2 87810032 missense probably benign 0.00
Z1088:Olfr1145 UTSW 2 87810746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCTCCAAGGGATTCTGTCTG -3'
(R):5'- TTGGAATGCCACTTAGCCAG -3'

Sequencing Primer
(F):5'- CCAAGGGATTCTGTCTGCACTG -3'
(R):5'- ACTTAGCCAGGAGCCTGCTG -3'
Posted On2015-06-24