Incidental Mutation 'R4327:Med12l'
ID 324402
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Name mediator complex subunit 12-like
Synonyms
MMRRC Submission 041097-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.257) question?
Stock # R4327 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 58913246-59226103 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59172688 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1813 (S1813P)
Ref Sequence ENSEMBL: ENSMUSP00000142903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000199609] [ENSMUST00000199659]
AlphaFold Q8BQM9
Predicted Effect probably benign
Transcript: ENSMUST00000040325
AA Change: S1780P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476
AA Change: S1780P

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050360
SMART Domains Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164225
AA Change: S1815P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476
AA Change: S1815P

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199400
Predicted Effect probably benign
Transcript: ENSMUST00000199609
SMART Domains Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199659
AA Change: S1813P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476
AA Change: S1813P

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Meta Mutation Damage Score 0.0641 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,221,664 (GRCm39) D55G possibly damaging Het
Alcam T C 16: 52,073,579 (GRCm39) N549S possibly damaging Het
Arap2 A T 5: 62,779,206 (GRCm39) H1461Q possibly damaging Het
Arhgef12 C A 9: 42,886,525 (GRCm39) E1152* probably null Het
Arrdc5 T C 17: 56,601,420 (GRCm39) E235G possibly damaging Het
Atp1a3 A G 7: 24,687,056 (GRCm39) probably benign Het
Bcl2l1 A G 2: 152,624,099 (GRCm39) V223A probably benign Het
C9orf72 T A 4: 35,225,985 (GRCm39) probably benign Het
Cela3b G T 4: 137,151,242 (GRCm39) A137E probably benign Het
Col13a1 T C 10: 61,699,758 (GRCm39) T476A unknown Het
Col16a1 T C 4: 129,988,344 (GRCm39) probably null Het
Ctcfl G A 2: 172,955,299 (GRCm39) probably benign Het
Cyp2j8 T A 4: 96,395,566 (GRCm39) T20S probably benign Het
Fastkd2 A G 1: 63,791,516 (GRCm39) K675E probably benign Het
Fsip2 A T 2: 82,817,403 (GRCm39) I4379F probably benign Het
Gm10722 T C 9: 3,000,937 (GRCm39) C6R probably benign Het
Hmgxb3 A T 18: 61,300,611 (GRCm39) M155K probably benign Het
Ip6k2 G A 9: 108,682,847 (GRCm39) R319Q probably benign Het
Kcnn1 A T 8: 71,305,307 (GRCm39) V301E probably damaging Het
Kcnq4 T C 4: 120,568,561 (GRCm39) E385G probably benign Het
Klhl28 G A 12: 64,996,952 (GRCm39) A463V probably damaging Het
Lhb A G 7: 45,070,383 (GRCm39) R3G possibly damaging Het
Lingo2 T A 4: 35,708,462 (GRCm39) D506V probably damaging Het
Macf1 C T 4: 123,276,005 (GRCm39) A4176T probably damaging Het
Marchf6 C T 15: 31,498,887 (GRCm39) E137K probably benign Het
Mpp3 T C 11: 101,914,337 (GRCm39) probably benign Het
Muc2 A C 7: 141,281,577 (GRCm39) S479R probably damaging Het
Or11g27 T A 14: 50,770,971 (GRCm39) I34N probably benign Het
Or12e10 G T 2: 87,640,496 (GRCm39) V111L probably benign Het
Or2t1 T A 14: 14,328,193 (GRCm38) F27L probably damaging Het
Or52n1 G A 7: 104,382,833 (GRCm39) T246I probably damaging Het
Pafah1b1 T C 11: 74,573,066 (GRCm39) T333A probably benign Het
Palm G A 10: 79,643,520 (GRCm39) G83S probably benign Het
Pcdhb9 A T 18: 37,534,875 (GRCm39) S290C probably benign Het
Pcdhb9 G T 18: 37,534,876 (GRCm39) S290I probably benign Het
Pdgfrb A T 18: 61,204,792 (GRCm39) I551F possibly damaging Het
Pex26 A T 6: 121,164,373 (GRCm39) E172V probably damaging Het
Pitrm1 A G 13: 6,629,809 (GRCm39) probably benign Het
Ptprs C A 17: 56,754,468 (GRCm39) A191S possibly damaging Het
Rdm1 T A 11: 101,521,734 (GRCm39) V92E probably damaging Het
Scn7a A G 2: 66,567,815 (GRCm39) F260L probably damaging Het
Serpinb3a T A 1: 106,979,500 (GRCm39) M1L probably damaging Het
Sh3d19 T C 3: 86,031,020 (GRCm39) I728T probably benign Het
Sin3a T C 9: 57,002,642 (GRCm39) L178P probably damaging Het
Slc13a1 A G 6: 24,103,478 (GRCm39) V355A probably benign Het
St7 G A 6: 17,819,287 (GRCm39) V64M probably damaging Het
Tcf25 T A 8: 124,127,882 (GRCm39) L622* probably null Het
Tiam1 A G 16: 89,652,779 (GRCm39) V781A possibly damaging Het
Tigd2 C A 6: 59,187,562 (GRCm39) T143K probably benign Het
Tmem107 G T 11: 68,962,301 (GRCm39) probably null Het
Tmem161b G A 13: 84,399,359 (GRCm39) G5D probably damaging Het
Tonsl G A 15: 76,523,916 (GRCm39) A28V probably benign Het
Treml4 T C 17: 48,581,417 (GRCm39) Y222H probably damaging Het
Trp53bp1 A T 2: 121,087,131 (GRCm39) V175D probably damaging Het
Zfp184 T C 13: 22,144,072 (GRCm39) Y593H probably damaging Het
Zfp286 A G 11: 62,670,844 (GRCm39) C410R probably damaging Het
Zfp934 T G 13: 62,665,373 (GRCm39) N312H probably benign Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 58,949,757 (GRCm39) missense probably damaging 0.98
IGL00561:Med12l APN 3 59,135,245 (GRCm39) missense probably benign
IGL00974:Med12l APN 3 58,990,435 (GRCm39) missense probably damaging 1.00
IGL01024:Med12l APN 3 58,980,762 (GRCm39) missense probably damaging 1.00
IGL01094:Med12l APN 3 59,001,076 (GRCm39) missense probably damaging 0.99
IGL01134:Med12l APN 3 58,949,696 (GRCm39) missense possibly damaging 0.91
IGL01535:Med12l APN 3 59,169,680 (GRCm39) missense probably damaging 1.00
IGL01653:Med12l APN 3 59,169,314 (GRCm39) missense probably damaging 1.00
IGL01735:Med12l APN 3 59,170,675 (GRCm39) missense probably damaging 1.00
IGL01972:Med12l APN 3 59,169,314 (GRCm39) missense probably damaging 1.00
IGL02005:Med12l APN 3 59,152,368 (GRCm39) missense probably damaging 1.00
IGL02098:Med12l APN 3 59,183,276 (GRCm39) missense possibly damaging 0.92
IGL02115:Med12l APN 3 58,975,740 (GRCm39) missense probably benign 0.00
IGL02231:Med12l APN 3 59,153,303 (GRCm39) missense probably damaging 1.00
IGL02259:Med12l APN 3 59,153,264 (GRCm39) missense probably damaging 1.00
IGL02369:Med12l APN 3 59,164,794 (GRCm39) missense probably benign 0.00
IGL02424:Med12l APN 3 59,000,143 (GRCm39) missense probably benign 0.21
IGL02501:Med12l APN 3 59,169,397 (GRCm39) missense possibly damaging 0.71
IGL02525:Med12l APN 3 58,975,789 (GRCm39) missense probably benign 0.01
IGL02530:Med12l APN 3 58,984,510 (GRCm39) missense probably damaging 1.00
IGL02735:Med12l APN 3 59,001,067 (GRCm39) missense probably damaging 1.00
IGL02865:Med12l APN 3 59,201,713 (GRCm39) missense probably damaging 1.00
IGL03183:Med12l APN 3 58,944,976 (GRCm39) splice site probably null
IGL03264:Med12l APN 3 59,208,788 (GRCm39) nonsense probably null
FR4304:Med12l UTSW 3 59,183,403 (GRCm39) small insertion probably benign
FR4340:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
FR4342:Med12l UTSW 3 59,183,415 (GRCm39) small insertion probably benign
FR4342:Med12l UTSW 3 59,183,409 (GRCm39) small insertion probably benign
FR4449:Med12l UTSW 3 59,183,384 (GRCm39) nonsense probably null
FR4548:Med12l UTSW 3 59,183,403 (GRCm39) small insertion probably benign
FR4589:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
FR4976:Med12l UTSW 3 59,183,398 (GRCm39) small insertion probably benign
P0007:Med12l UTSW 3 58,998,816 (GRCm39) splice site probably benign
P0045:Med12l UTSW 3 58,998,956 (GRCm39) missense probably damaging 0.99
R0030:Med12l UTSW 3 59,156,076 (GRCm39) missense probably damaging 1.00
R0030:Med12l UTSW 3 59,156,076 (GRCm39) missense probably damaging 1.00
R0148:Med12l UTSW 3 58,945,075 (GRCm39) missense probably damaging 1.00
R0325:Med12l UTSW 3 58,984,480 (GRCm39) missense possibly damaging 0.88
R0330:Med12l UTSW 3 59,135,123 (GRCm39) missense probably damaging 1.00
R0388:Med12l UTSW 3 59,000,925 (GRCm39) splice site probably benign
R0542:Med12l UTSW 3 58,949,822 (GRCm39) missense probably damaging 1.00
R0624:Med12l UTSW 3 58,945,123 (GRCm39) nonsense probably null
R0625:Med12l UTSW 3 59,154,858 (GRCm39) missense probably damaging 1.00
R0671:Med12l UTSW 3 59,172,350 (GRCm39) missense probably damaging 1.00
R0706:Med12l UTSW 3 59,169,401 (GRCm39) missense probably damaging 1.00
R0785:Med12l UTSW 3 59,168,253 (GRCm39) missense probably damaging 1.00
R1054:Med12l UTSW 3 59,156,072 (GRCm39) missense probably damaging 0.99
R1102:Med12l UTSW 3 59,152,257 (GRCm39) missense probably damaging 0.99
R1391:Med12l UTSW 3 58,945,159 (GRCm39) missense probably benign 0.00
R1501:Med12l UTSW 3 59,168,256 (GRCm39) critical splice donor site probably null
R1544:Med12l UTSW 3 59,172,661 (GRCm39) missense possibly damaging 0.71
R1662:Med12l UTSW 3 59,001,038 (GRCm39) missense probably damaging 1.00
R1670:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
R1839:Med12l UTSW 3 58,975,740 (GRCm39) missense probably benign
R1854:Med12l UTSW 3 59,168,193 (GRCm39) missense probably damaging 1.00
R2045:Med12l UTSW 3 59,169,731 (GRCm39) nonsense probably null
R2070:Med12l UTSW 3 59,152,326 (GRCm39) missense probably damaging 1.00
R2132:Med12l UTSW 3 59,172,703 (GRCm39) splice site probably null
R2290:Med12l UTSW 3 59,152,359 (GRCm39) missense probably damaging 1.00
R2325:Med12l UTSW 3 59,139,875 (GRCm39) missense probably damaging 0.99
R2352:Med12l UTSW 3 59,148,113 (GRCm39) missense probably damaging 1.00
R2484:Med12l UTSW 3 59,205,259 (GRCm39) missense probably benign 0.18
R2906:Med12l UTSW 3 59,164,503 (GRCm39) missense probably damaging 1.00
R3735:Med12l UTSW 3 58,998,916 (GRCm39) missense probably damaging 1.00
R3736:Med12l UTSW 3 58,998,916 (GRCm39) missense probably damaging 1.00
R3774:Med12l UTSW 3 59,155,363 (GRCm39) missense probably damaging 0.97
R3957:Med12l UTSW 3 58,980,589 (GRCm39) missense probably damaging 0.99
R4020:Med12l UTSW 3 59,155,363 (GRCm39) missense probably damaging 0.97
R4087:Med12l UTSW 3 59,205,342 (GRCm39) missense probably benign 0.00
R4231:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4233:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4235:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4236:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4328:Med12l UTSW 3 59,172,688 (GRCm39) missense probably benign 0.01
R4346:Med12l UTSW 3 58,938,976 (GRCm39) missense probably damaging 1.00
R4543:Med12l UTSW 3 58,998,929 (GRCm39) missense probably damaging 1.00
R4559:Med12l UTSW 3 58,914,523 (GRCm39) critical splice donor site probably null
R4776:Med12l UTSW 3 59,140,633 (GRCm39) missense probably damaging 1.00
R4877:Med12l UTSW 3 59,152,214 (GRCm39) missense probably damaging 1.00
R4983:Med12l UTSW 3 59,169,350 (GRCm39) missense probably damaging 1.00
R5114:Med12l UTSW 3 59,167,109 (GRCm39) missense possibly damaging 0.85
R5125:Med12l UTSW 3 59,174,635 (GRCm39) missense possibly damaging 0.83
R5230:Med12l UTSW 3 59,153,209 (GRCm39) missense probably damaging 1.00
R5407:Med12l UTSW 3 59,165,622 (GRCm39) missense probably damaging 1.00
R5426:Med12l UTSW 3 59,156,143 (GRCm39) missense probably damaging 0.98
R5439:Med12l UTSW 3 59,170,634 (GRCm39) missense probably null 1.00
R5449:Med12l UTSW 3 59,167,127 (GRCm39) missense probably damaging 1.00
R5596:Med12l UTSW 3 59,159,771 (GRCm39) missense probably benign 0.45
R5716:Med12l UTSW 3 59,208,798 (GRCm39) critical splice donor site probably null
R5833:Med12l UTSW 3 59,172,647 (GRCm39) missense possibly damaging 0.95
R5883:Med12l UTSW 3 58,998,889 (GRCm39) missense probably damaging 1.00
R6264:Med12l UTSW 3 59,163,423 (GRCm39) missense probably damaging 1.00
R6269:Med12l UTSW 3 59,135,243 (GRCm39) missense probably damaging 1.00
R6394:Med12l UTSW 3 59,142,508 (GRCm39) missense probably damaging 1.00
R6400:Med12l UTSW 3 59,155,332 (GRCm39) missense probably damaging 1.00
R6475:Med12l UTSW 3 59,164,500 (GRCm39) missense probably damaging 1.00
R6489:Med12l UTSW 3 59,164,828 (GRCm39) missense probably damaging 0.99
R6654:Med12l UTSW 3 59,169,713 (GRCm39) missense probably damaging 1.00
R6881:Med12l UTSW 3 59,174,586 (GRCm39) missense probably benign 0.00
R7110:Med12l UTSW 3 59,169,645 (GRCm39) missense possibly damaging 0.92
R7134:Med12l UTSW 3 59,001,180 (GRCm39) nonsense probably null
R7137:Med12l UTSW 3 59,165,675 (GRCm39) missense probably damaging 1.00
R7159:Med12l UTSW 3 59,183,438 (GRCm39) missense probably benign
R7341:Med12l UTSW 3 58,949,824 (GRCm39) missense possibly damaging 0.53
R7349:Med12l UTSW 3 59,165,746 (GRCm39) missense probably damaging 1.00
R7413:Med12l UTSW 3 58,998,971 (GRCm39) missense probably benign 0.00
R7495:Med12l UTSW 3 59,152,194 (GRCm39) missense probably damaging 1.00
R7678:Med12l UTSW 3 58,984,141 (GRCm39) missense probably damaging 1.00
R7697:Med12l UTSW 3 59,148,078 (GRCm39) missense probably damaging 1.00
R7714:Med12l UTSW 3 59,001,007 (GRCm39) missense probably benign 0.17
R7725:Med12l UTSW 3 59,163,413 (GRCm39) missense probably damaging 1.00
R7846:Med12l UTSW 3 59,172,355 (GRCm39) missense probably damaging 1.00
R7852:Med12l UTSW 3 59,155,332 (GRCm39) missense probably damaging 1.00
R8080:Med12l UTSW 3 59,172,607 (GRCm39) missense probably damaging 1.00
R8181:Med12l UTSW 3 59,169,389 (GRCm39) missense probably damaging 1.00
R8223:Med12l UTSW 3 58,993,784 (GRCm39) missense possibly damaging 0.79
R8560:Med12l UTSW 3 58,945,026 (GRCm39) missense probably damaging 1.00
R8708:Med12l UTSW 3 59,159,751 (GRCm39) missense probably benign 0.00
R8865:Med12l UTSW 3 58,979,303 (GRCm39) missense probably benign
R8947:Med12l UTSW 3 58,984,443 (GRCm39) splice site probably benign
R8976:Med12l UTSW 3 59,183,329 (GRCm39) missense probably damaging 0.99
R9016:Med12l UTSW 3 59,163,294 (GRCm39) missense probably damaging 0.96
R9183:Med12l UTSW 3 58,984,498 (GRCm39) missense probably damaging 1.00
R9487:Med12l UTSW 3 59,155,353 (GRCm39) missense probably benign
R9526:Med12l UTSW 3 58,984,207 (GRCm39) missense probably damaging 0.96
R9802:Med12l UTSW 3 59,169,346 (GRCm39) missense probably damaging 1.00
RF004:Med12l UTSW 3 59,183,390 (GRCm39) small insertion probably benign
RF011:Med12l UTSW 3 59,183,401 (GRCm39) small insertion probably benign
RF013:Med12l UTSW 3 59,183,387 (GRCm39) small insertion probably benign
RF020:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
RF021:Med12l UTSW 3 58,980,711 (GRCm39) missense probably benign 0.19
RF027:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF027:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF030:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,408 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF037:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
RF040:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF040:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF041:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF041:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF049:Med12l UTSW 3 59,183,390 (GRCm39) small insertion probably benign
RF050:Med12l UTSW 3 59,183,394 (GRCm39) small insertion probably benign
RF053:Med12l UTSW 3 59,183,414 (GRCm39) small insertion probably benign
RF055:Med12l UTSW 3 59,183,404 (GRCm39) small insertion probably benign
RF056:Med12l UTSW 3 59,183,414 (GRCm39) small insertion probably benign
RF057:Med12l UTSW 3 59,183,401 (GRCm39) small insertion probably benign
RF063:Med12l UTSW 3 59,183,394 (GRCm39) small insertion probably benign
RF063:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
X0062:Med12l UTSW 3 59,140,600 (GRCm39) missense probably damaging 1.00
Z1176:Med12l UTSW 3 59,203,538 (GRCm39) missense probably benign 0.00
Z1176:Med12l UTSW 3 59,152,364 (GRCm39) missense probably damaging 1.00
Z1176:Med12l UTSW 3 58,998,838 (GRCm39) missense probably damaging 0.98
Z1177:Med12l UTSW 3 59,155,296 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGCAGCACTTCCTTCTG -3'
(R):5'- AGCTTTCTACCTGTCACCTATGAG -3'

Sequencing Primer
(F):5'- AGCACTTCCTTCTGTACCACACG -3'
(R):5'- ACCTGTCACCTATGAGAATTCATTCG -3'
Posted On 2015-06-24