Incidental Mutation 'R4327:Cela3b'
ID324410
Institutional Source Beutler Lab
Gene Symbol Cela3b
Ensembl Gene ENSMUSG00000023433
Gene Namechymotrypsin-like elastase family, member 3B
Synonyms2310074F01Rik, Ela3b, Ela3, 0910001F22Rik
MMRRC Submission 041097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4327 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137420999-137430540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 137423931 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 137 (A137E)
Ref Sequence ENSEMBL: ENSMUSP00000099581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102522]
Predicted Effect probably benign
Transcript: ENSMUST00000102522
AA Change: A137E

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099581
Gene: ENSMUSG00000023433
AA Change: A137E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 27 262 8.81e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134565
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, elastase 3B has little elastolytic activity. Like most of the human elastases, elastase 3B is secreted from the pancreas as a zymogen and, like other serine proteases such as trypsin, chymotrypsin and kallikrein, it has a digestive function in the intestine. Elastase 3B preferentially cleaves proteins after alanine residues. Elastase 3B may also function in the intestinal transport and metabolism of cholesterol. Both elastase 3A and elastase 3B have been referred to as protease E and as elastase 1, and excretion of this protein in fecal material is frequently used as a measure of pancreatic function in clinical assays. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,182,505 D55G possibly damaging Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Alcam T C 16: 52,253,216 N549S possibly damaging Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Arhgef12 C A 9: 42,975,229 E1152* probably null Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atp1a3 A G 7: 24,987,631 probably benign Het
Bcl2l1 A G 2: 152,782,179 V223A probably benign Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Col16a1 T C 4: 130,094,551 probably null Het
Ctcfl G A 2: 173,113,506 probably benign Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Fastkd2 A G 1: 63,752,357 K675E probably benign Het
Fsip2 A T 2: 82,987,059 I4379F probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hmgxb3 A T 18: 61,167,539 M155K probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kcnn1 A T 8: 70,852,663 V301E probably damaging Het
Kcnq4 T C 4: 120,711,364 E385G probably benign Het
Klhl28 G A 12: 64,950,178 A463V probably damaging Het
Lhb A G 7: 45,420,959 R3G possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
March6 C T 15: 31,498,741 E137K probably benign Het
Med12l T C 3: 59,265,267 S1813P probably benign Het
Mpp3 T C 11: 102,023,511 probably benign Het
Muc2 A C 7: 141,695,334 S479R probably damaging Het
Olfr1145 G T 2: 87,810,152 V111L probably benign Het
Olfr31 T A 14: 14,328,193 F27L probably damaging Het
Olfr664 G A 7: 104,733,626 T246I probably damaging Het
Olfr743 T A 14: 50,533,514 I34N probably benign Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Palm G A 10: 79,807,686 G83S probably benign Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Pdgfrb A T 18: 61,071,720 I551F possibly damaging Het
Pex26 A T 6: 121,187,414 E172V probably damaging Het
Pitrm1 A G 13: 6,579,773 probably benign Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rdm1 T A 11: 101,630,908 V92E probably damaging Het
Scn7a A G 2: 66,737,471 F260L probably damaging Het
Serpinb3a T A 1: 107,051,770 M1L probably damaging Het
Sh3d19 T C 3: 86,123,713 I728T probably benign Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tiam1 A G 16: 89,855,891 V781A possibly damaging Het
Tigd2 C A 6: 59,210,577 T143K probably benign Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem161b G A 13: 84,251,240 G5D probably damaging Het
Tonsl G A 15: 76,639,716 A28V probably benign Het
Treml4 T C 17: 48,274,389 Y222H probably damaging Het
Trp53bp1 A T 2: 121,256,650 V175D probably damaging Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp286 A G 11: 62,780,018 C410R probably damaging Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in Cela3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Cela3b APN 4 137423281 missense probably damaging 1.00
IGL00708:Cela3b APN 4 137421969 missense probably benign
IGL01301:Cela3b APN 4 137423843 critical splice donor site probably null
IGL01613:Cela3b APN 4 137425071 missense possibly damaging 0.66
ANU18:Cela3b UTSW 4 137423843 critical splice donor site probably null
R0669:Cela3b UTSW 4 137428530 missense probably benign 0.06
R2937:Cela3b UTSW 4 137423263 missense probably benign 0.01
R2938:Cela3b UTSW 4 137423263 missense probably benign 0.01
R4451:Cela3b UTSW 4 137421044 utr 3 prime probably benign
R5059:Cela3b UTSW 4 137424870 missense probably benign 0.00
R5707:Cela3b UTSW 4 137424856 missense probably damaging 1.00
R7952:Cela3b UTSW 4 137421908 missense probably benign 0.27
X0019:Cela3b UTSW 4 137423310 missense probably damaging 1.00
X0019:Cela3b UTSW 4 137423311 missense probably damaging 1.00
Z1177:Cela3b UTSW 4 137428484 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGCATCCCAAAATGATCCAG -3'
(R):5'- CAAATGACTTAGGAAGCACCAG -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- CACTTGCAGAGCTCTGAGTTCAAG -3'
Posted On2015-06-24