Incidental Mutation 'R4327:Sin3a'
ID324423
Institutional Source Beutler Lab
Gene Symbol Sin3a
Ensembl Gene ENSMUSG00000042557
Gene Nametranscriptional regulator, SIN3A (yeast)
SynonymsSin3, mSin3A
MMRRC Submission 041097-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4327 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57072040-57128366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57095358 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 178 (L178P)
Ref Sequence ENSEMBL: ENSMUSP00000126601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000163400] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678]
Predicted Effect probably damaging
Transcript: ENSMUST00000049169
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: L178P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125333
Predicted Effect probably damaging
Transcript: ENSMUST00000163400
AA Change: L119P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126718
Gene: ENSMUSG00000042557
AA Change: L119P

DomainStartEndE-ValueType
Pfam:PAH 82 128 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165927
Predicted Effect probably damaging
Transcript: ENSMUST00000167715
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: L178P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168177
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: L178P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 142 186 5.3e-22 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 323 380 9.6e-22 PFAM
Pfam:PAH 479 523 8.1e-11 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
Pfam:Sin3a_C 887 1190 1.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168502
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: L178P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1138 1154 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168678
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: L178P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Meta Mutation Damage Score 0.9686 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,182,505 D55G possibly damaging Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
Alcam T C 16: 52,253,216 N549S possibly damaging Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Arhgef12 C A 9: 42,975,229 E1152* probably null Het
Arrdc5 T C 17: 56,294,420 E235G possibly damaging Het
Atp1a3 A G 7: 24,987,631 probably benign Het
Bcl2l1 A G 2: 152,782,179 V223A probably benign Het
Cela3b G T 4: 137,423,931 A137E probably benign Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Col16a1 T C 4: 130,094,551 probably null Het
Ctcfl G A 2: 173,113,506 probably benign Het
Cyp2j8 T A 4: 96,507,329 T20S probably benign Het
Fastkd2 A G 1: 63,752,357 K675E probably benign Het
Fsip2 A T 2: 82,987,059 I4379F probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hmgxb3 A T 18: 61,167,539 M155K probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kcnn1 A T 8: 70,852,663 V301E probably damaging Het
Kcnq4 T C 4: 120,711,364 E385G probably benign Het
Klhl28 G A 12: 64,950,178 A463V probably damaging Het
Lhb A G 7: 45,420,959 R3G possibly damaging Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Macf1 C T 4: 123,382,212 A4176T probably damaging Het
March6 C T 15: 31,498,741 E137K probably benign Het
Med12l T C 3: 59,265,267 S1813P probably benign Het
Mpp3 T C 11: 102,023,511 probably benign Het
Muc2 A C 7: 141,695,334 S479R probably damaging Het
Olfr1145 G T 2: 87,810,152 V111L probably benign Het
Olfr31 T A 14: 14,328,193 F27L probably damaging Het
Olfr664 G A 7: 104,733,626 T246I probably damaging Het
Olfr743 T A 14: 50,533,514 I34N probably benign Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Palm G A 10: 79,807,686 G83S probably benign Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Pdgfrb A T 18: 61,071,720 I551F possibly damaging Het
Pex26 A T 6: 121,187,414 E172V probably damaging Het
Pitrm1 A G 13: 6,579,773 probably benign Het
Ptprs C A 17: 56,447,468 A191S possibly damaging Het
Rdm1 T A 11: 101,630,908 V92E probably damaging Het
Scn7a A G 2: 66,737,471 F260L probably damaging Het
Serpinb3a T A 1: 107,051,770 M1L probably damaging Het
Sh3d19 T C 3: 86,123,713 I728T probably benign Het
Slc13a1 A G 6: 24,103,479 V355A probably benign Het
St7 G A 6: 17,819,288 V64M probably damaging Het
Tcf25 T A 8: 123,401,143 L622* probably null Het
Tiam1 A G 16: 89,855,891 V781A possibly damaging Het
Tigd2 C A 6: 59,210,577 T143K probably benign Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem161b G A 13: 84,251,240 G5D probably damaging Het
Tonsl G A 15: 76,639,716 A28V probably benign Het
Treml4 T C 17: 48,274,389 Y222H probably damaging Het
Trp53bp1 A T 2: 121,256,650 V175D probably damaging Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp286 A G 11: 62,780,018 C410R probably damaging Het
Zfp934 T G 13: 62,517,559 N312H probably benign Het
Other mutations in Sin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Sin3a APN 9 57097901 missense probably damaging 1.00
IGL00836:Sin3a APN 9 57107345 splice site probably null
IGL00913:Sin3a APN 9 57098118 missense probably benign 0.01
IGL01721:Sin3a APN 9 57095325 missense probably damaging 1.00
IGL01964:Sin3a APN 9 57107347 splice site probably benign
IGL02333:Sin3a APN 9 57107559 missense possibly damaging 0.86
IGL02673:Sin3a APN 9 57107441 missense probably damaging 0.99
Delicate UTSW 9 57103929 missense probably damaging 1.00
IGL03014:Sin3a UTSW 9 57095255 intron probably benign
PIT4519001:Sin3a UTSW 9 57095456 missense possibly damaging 0.86
R0024:Sin3a UTSW 9 57118253 intron probably benign
R0309:Sin3a UTSW 9 57110912 missense probably benign 0.00
R0511:Sin3a UTSW 9 57096895 nonsense probably null
R1205:Sin3a UTSW 9 57119175 missense probably damaging 1.00
R1365:Sin3a UTSW 9 57125203 nonsense probably null
R1496:Sin3a UTSW 9 57119158 missense possibly damaging 0.77
R1544:Sin3a UTSW 9 57103997 splice site probably benign
R1958:Sin3a UTSW 9 57105609 missense probably damaging 1.00
R1993:Sin3a UTSW 9 57101199 missense probably damaging 1.00
R2037:Sin3a UTSW 9 57096825 missense probably benign 0.14
R2065:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R2079:Sin3a UTSW 9 57089523 missense probably benign
R2193:Sin3a UTSW 9 57117477 missense possibly damaging 0.93
R3004:Sin3a UTSW 9 57096834 nonsense probably null
R3929:Sin3a UTSW 9 57118137 missense probably damaging 0.98
R4326:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4329:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4765:Sin3a UTSW 9 57096803 missense probably benign 0.14
R4806:Sin3a UTSW 9 57086742 missense probably damaging 0.99
R4979:Sin3a UTSW 9 57118076 missense probably damaging 1.00
R5018:Sin3a UTSW 9 57110891 missense probably benign 0.00
R5368:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R5379:Sin3a UTSW 9 57110988 missense probably benign 0.10
R5391:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5395:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5519:Sin3a UTSW 9 57118173 critical splice donor site probably null
R5927:Sin3a UTSW 9 57111111 missense probably damaging 1.00
R5987:Sin3a UTSW 9 57127200 missense possibly damaging 0.75
R6083:Sin3a UTSW 9 57107540 missense probably damaging 1.00
R6161:Sin3a UTSW 9 57095424 missense possibly damaging 0.48
R6196:Sin3a UTSW 9 57103929 missense probably damaging 1.00
R6374:Sin3a UTSW 9 57117481 missense probably benign
R6456:Sin3a UTSW 9 57113701 missense possibly damaging 0.79
R6815:Sin3a UTSW 9 57117540 missense probably benign 0.02
R6900:Sin3a UTSW 9 57107574 missense probably damaging 1.00
R7051:Sin3a UTSW 9 57103934 missense probably damaging 1.00
R7081:Sin3a UTSW 9 57094471 missense probably null 1.00
R7285:Sin3a UTSW 9 57127299 missense possibly damaging 0.57
R7462:Sin3a UTSW 9 57095525 missense probably benign 0.00
R7538:Sin3a UTSW 9 57103926 missense possibly damaging 0.95
RF017:Sin3a UTSW 9 57127326 missense possibly damaging 0.90
X0026:Sin3a UTSW 9 57125192 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCCAAGTGTATGAATGGCTTTG -3'
(R):5'- ACCTTGCTGACTTTGGCAGC -3'

Sequencing Primer
(F):5'- AAGTGTATGAATGGCTTTGGAATTTG -3'
(R):5'- GCTGAGGAGCTGGCTGAG -3'
Posted On2015-06-24