Incidental Mutation 'R4327:Zfp286'
ID 324427
Institutional Source Beutler Lab
Gene Symbol Zfp286
Ensembl Gene ENSMUSG00000047342
Gene Name zinc finger protein 286
Synonyms
MMRRC Submission 041097-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R4327 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 62643403-62680288 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62670844 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 410 (C410R)
Ref Sequence ENSEMBL: ENSMUSP00000055517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054654] [ENSMUST00000108705] [ENSMUST00000207597]
AlphaFold Q8C0E6
Predicted Effect probably damaging
Transcript: ENSMUST00000054654
AA Change: C410R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055517
Gene: ENSMUSG00000047342
AA Change: C410R

DomainStartEndE-ValueType
KRAB 50 114 1.2e-17 SMART
ZnF_C2H2 241 263 2.75e-3 SMART
ZnF_C2H2 269 291 2.84e-5 SMART
ZnF_C2H2 296 318 1.03e-2 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 4.24e-4 SMART
ZnF_C2H2 380 402 4.79e-3 SMART
ZnF_C2H2 408 430 1.06e-4 SMART
ZnF_C2H2 436 458 1.06e-4 SMART
ZnF_C2H2 464 486 3.95e-4 SMART
ZnF_C2H2 492 514 1.15e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082758
Predicted Effect probably benign
Transcript: ENSMUST00000108705
SMART Domains Protein: ENSMUSP00000104345
Gene: ENSMUSG00000047342

DomainStartEndE-ValueType
KRAB 50 114 1.2e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152602
Predicted Effect probably benign
Transcript: ENSMUST00000207597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149230
Meta Mutation Damage Score 0.9631 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,221,664 (GRCm39) D55G possibly damaging Het
Alcam T C 16: 52,073,579 (GRCm39) N549S possibly damaging Het
Arap2 A T 5: 62,779,206 (GRCm39) H1461Q possibly damaging Het
Arhgef12 C A 9: 42,886,525 (GRCm39) E1152* probably null Het
Arrdc5 T C 17: 56,601,420 (GRCm39) E235G possibly damaging Het
Atp1a3 A G 7: 24,687,056 (GRCm39) probably benign Het
Bcl2l1 A G 2: 152,624,099 (GRCm39) V223A probably benign Het
C9orf72 T A 4: 35,225,985 (GRCm39) probably benign Het
Cela3b G T 4: 137,151,242 (GRCm39) A137E probably benign Het
Col13a1 T C 10: 61,699,758 (GRCm39) T476A unknown Het
Col16a1 T C 4: 129,988,344 (GRCm39) probably null Het
Ctcfl G A 2: 172,955,299 (GRCm39) probably benign Het
Cyp2j8 T A 4: 96,395,566 (GRCm39) T20S probably benign Het
Fastkd2 A G 1: 63,791,516 (GRCm39) K675E probably benign Het
Fsip2 A T 2: 82,817,403 (GRCm39) I4379F probably benign Het
Gm10722 T C 9: 3,000,937 (GRCm39) C6R probably benign Het
Hmgxb3 A T 18: 61,300,611 (GRCm39) M155K probably benign Het
Ip6k2 G A 9: 108,682,847 (GRCm39) R319Q probably benign Het
Kcnn1 A T 8: 71,305,307 (GRCm39) V301E probably damaging Het
Kcnq4 T C 4: 120,568,561 (GRCm39) E385G probably benign Het
Klhl28 G A 12: 64,996,952 (GRCm39) A463V probably damaging Het
Lhb A G 7: 45,070,383 (GRCm39) R3G possibly damaging Het
Lingo2 T A 4: 35,708,462 (GRCm39) D506V probably damaging Het
Macf1 C T 4: 123,276,005 (GRCm39) A4176T probably damaging Het
Marchf6 C T 15: 31,498,887 (GRCm39) E137K probably benign Het
Med12l T C 3: 59,172,688 (GRCm39) S1813P probably benign Het
Mpp3 T C 11: 101,914,337 (GRCm39) probably benign Het
Muc2 A C 7: 141,281,577 (GRCm39) S479R probably damaging Het
Or11g27 T A 14: 50,770,971 (GRCm39) I34N probably benign Het
Or12e10 G T 2: 87,640,496 (GRCm39) V111L probably benign Het
Or2t1 T A 14: 14,328,193 (GRCm38) F27L probably damaging Het
Or52n1 G A 7: 104,382,833 (GRCm39) T246I probably damaging Het
Pafah1b1 T C 11: 74,573,066 (GRCm39) T333A probably benign Het
Palm G A 10: 79,643,520 (GRCm39) G83S probably benign Het
Pcdhb9 A T 18: 37,534,875 (GRCm39) S290C probably benign Het
Pcdhb9 G T 18: 37,534,876 (GRCm39) S290I probably benign Het
Pdgfrb A T 18: 61,204,792 (GRCm39) I551F possibly damaging Het
Pex26 A T 6: 121,164,373 (GRCm39) E172V probably damaging Het
Pitrm1 A G 13: 6,629,809 (GRCm39) probably benign Het
Ptprs C A 17: 56,754,468 (GRCm39) A191S possibly damaging Het
Rdm1 T A 11: 101,521,734 (GRCm39) V92E probably damaging Het
Scn7a A G 2: 66,567,815 (GRCm39) F260L probably damaging Het
Serpinb3a T A 1: 106,979,500 (GRCm39) M1L probably damaging Het
Sh3d19 T C 3: 86,031,020 (GRCm39) I728T probably benign Het
Sin3a T C 9: 57,002,642 (GRCm39) L178P probably damaging Het
Slc13a1 A G 6: 24,103,478 (GRCm39) V355A probably benign Het
St7 G A 6: 17,819,287 (GRCm39) V64M probably damaging Het
Tcf25 T A 8: 124,127,882 (GRCm39) L622* probably null Het
Tiam1 A G 16: 89,652,779 (GRCm39) V781A possibly damaging Het
Tigd2 C A 6: 59,187,562 (GRCm39) T143K probably benign Het
Tmem107 G T 11: 68,962,301 (GRCm39) probably null Het
Tmem161b G A 13: 84,399,359 (GRCm39) G5D probably damaging Het
Tonsl G A 15: 76,523,916 (GRCm39) A28V probably benign Het
Treml4 T C 17: 48,581,417 (GRCm39) Y222H probably damaging Het
Trp53bp1 A T 2: 121,087,131 (GRCm39) V175D probably damaging Het
Zfp184 T C 13: 22,144,072 (GRCm39) Y593H probably damaging Het
Zfp934 T G 13: 62,665,373 (GRCm39) N312H probably benign Het
Other mutations in Zfp286
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02659:Zfp286 APN 11 62,674,563 (GRCm39) missense possibly damaging 0.54
IGL02745:Zfp286 APN 11 62,671,700 (GRCm39) missense probably damaging 1.00
IGL02826:Zfp286 APN 11 62,678,786 (GRCm39) missense probably damaging 0.99
R0233:Zfp286 UTSW 11 62,671,219 (GRCm39) missense possibly damaging 0.75
R0233:Zfp286 UTSW 11 62,671,219 (GRCm39) missense possibly damaging 0.75
R0318:Zfp286 UTSW 11 62,675,788 (GRCm39) missense probably damaging 1.00
R1954:Zfp286 UTSW 11 62,674,534 (GRCm39) missense possibly damaging 0.46
R1994:Zfp286 UTSW 11 62,670,646 (GRCm39) missense probably damaging 1.00
R2186:Zfp286 UTSW 11 62,671,287 (GRCm39) missense probably damaging 0.97
R4258:Zfp286 UTSW 11 62,671,896 (GRCm39) missense probably benign 0.07
R4453:Zfp286 UTSW 11 62,671,030 (GRCm39) missense probably damaging 1.00
R4479:Zfp286 UTSW 11 62,671,030 (GRCm39) missense probably damaging 1.00
R4647:Zfp286 UTSW 11 62,674,559 (GRCm39) nonsense probably null
R4667:Zfp286 UTSW 11 62,671,428 (GRCm39) missense probably benign 0.00
R4883:Zfp286 UTSW 11 62,671,455 (GRCm39) missense probably benign 0.01
R4978:Zfp286 UTSW 11 62,679,754 (GRCm39) critical splice donor site probably null
R5120:Zfp286 UTSW 11 62,671,551 (GRCm39) missense probably benign 0.40
R5533:Zfp286 UTSW 11 62,671,796 (GRCm39) intron probably benign
R7236:Zfp286 UTSW 11 62,674,496 (GRCm39) critical splice donor site probably null
R7464:Zfp286 UTSW 11 62,671,627 (GRCm39) missense probably benign 0.00
R8065:Zfp286 UTSW 11 62,644,345 (GRCm39) missense unknown
R8067:Zfp286 UTSW 11 62,644,345 (GRCm39) missense unknown
R8716:Zfp286 UTSW 11 62,671,817 (GRCm39) missense unknown
R9351:Zfp286 UTSW 11 62,670,801 (GRCm39) missense probably damaging 0.97
Z1186:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1186:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Z1187:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1187:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Z1188:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Z1188:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1189:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1189:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Z1190:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1190:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Z1191:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1191:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Z1192:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1192:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGGGGCTGCTCTTGAA -3'
(R):5'- CGCTTGGGAAAAGACTGAAG -3'

Sequencing Primer
(F):5'- TCGGTACACCTGAAAGGCTTC -3'
(R):5'- GTTCATCCCTTGAGGTACATCAGAG -3'
Posted On 2015-06-24