Incidental Mutation 'R4327:Mpp3'
ID 324431
Institutional Source Beutler Lab
Gene Symbol Mpp3
Ensembl Gene ENSMUSG00000052373
Gene Name membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Synonyms Dlgh3
MMRRC Submission 041097-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4327 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 101890478-101919287 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to C at 101914337 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062801] [ENSMUST00000100400] [ENSMUST00000107167] [ENSMUST00000107168]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062801
SMART Domains Protein: ENSMUSP00000055469
Gene: ENSMUSG00000052373

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100400
SMART Domains Protein: ENSMUSP00000097969
Gene: ENSMUSG00000052373

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107167
SMART Domains Protein: ENSMUSP00000102785
Gene: ENSMUSG00000052373

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 215 5.86e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107168
SMART Domains Protein: ENSMUSP00000102786
Gene: ENSMUSG00000052373

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147838
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. This protein contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. Alternatively spliced transcript variants have been identified. One transcript variant is experimentally supported, but it doesn't encode a protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,221,664 (GRCm39) D55G possibly damaging Het
Alcam T C 16: 52,073,579 (GRCm39) N549S possibly damaging Het
Arap2 A T 5: 62,779,206 (GRCm39) H1461Q possibly damaging Het
Arhgef12 C A 9: 42,886,525 (GRCm39) E1152* probably null Het
Arrdc5 T C 17: 56,601,420 (GRCm39) E235G possibly damaging Het
Atp1a3 A G 7: 24,687,056 (GRCm39) probably benign Het
Bcl2l1 A G 2: 152,624,099 (GRCm39) V223A probably benign Het
C9orf72 T A 4: 35,225,985 (GRCm39) probably benign Het
Cela3b G T 4: 137,151,242 (GRCm39) A137E probably benign Het
Col13a1 T C 10: 61,699,758 (GRCm39) T476A unknown Het
Col16a1 T C 4: 129,988,344 (GRCm39) probably null Het
Ctcfl G A 2: 172,955,299 (GRCm39) probably benign Het
Cyp2j8 T A 4: 96,395,566 (GRCm39) T20S probably benign Het
Fastkd2 A G 1: 63,791,516 (GRCm39) K675E probably benign Het
Fsip2 A T 2: 82,817,403 (GRCm39) I4379F probably benign Het
Gm10722 T C 9: 3,000,937 (GRCm39) C6R probably benign Het
Hmgxb3 A T 18: 61,300,611 (GRCm39) M155K probably benign Het
Ip6k2 G A 9: 108,682,847 (GRCm39) R319Q probably benign Het
Kcnn1 A T 8: 71,305,307 (GRCm39) V301E probably damaging Het
Kcnq4 T C 4: 120,568,561 (GRCm39) E385G probably benign Het
Klhl28 G A 12: 64,996,952 (GRCm39) A463V probably damaging Het
Lhb A G 7: 45,070,383 (GRCm39) R3G possibly damaging Het
Lingo2 T A 4: 35,708,462 (GRCm39) D506V probably damaging Het
Macf1 C T 4: 123,276,005 (GRCm39) A4176T probably damaging Het
Marchf6 C T 15: 31,498,887 (GRCm39) E137K probably benign Het
Med12l T C 3: 59,172,688 (GRCm39) S1813P probably benign Het
Muc2 A C 7: 141,281,577 (GRCm39) S479R probably damaging Het
Or11g27 T A 14: 50,770,971 (GRCm39) I34N probably benign Het
Or12e10 G T 2: 87,640,496 (GRCm39) V111L probably benign Het
Or2t1 T A 14: 14,328,193 (GRCm38) F27L probably damaging Het
Or52n1 G A 7: 104,382,833 (GRCm39) T246I probably damaging Het
Pafah1b1 T C 11: 74,573,066 (GRCm39) T333A probably benign Het
Palm G A 10: 79,643,520 (GRCm39) G83S probably benign Het
Pcdhb9 A T 18: 37,534,875 (GRCm39) S290C probably benign Het
Pcdhb9 G T 18: 37,534,876 (GRCm39) S290I probably benign Het
Pdgfrb A T 18: 61,204,792 (GRCm39) I551F possibly damaging Het
Pex26 A T 6: 121,164,373 (GRCm39) E172V probably damaging Het
Pitrm1 A G 13: 6,629,809 (GRCm39) probably benign Het
Ptprs C A 17: 56,754,468 (GRCm39) A191S possibly damaging Het
Rdm1 T A 11: 101,521,734 (GRCm39) V92E probably damaging Het
Scn7a A G 2: 66,567,815 (GRCm39) F260L probably damaging Het
Serpinb3a T A 1: 106,979,500 (GRCm39) M1L probably damaging Het
Sh3d19 T C 3: 86,031,020 (GRCm39) I728T probably benign Het
Sin3a T C 9: 57,002,642 (GRCm39) L178P probably damaging Het
Slc13a1 A G 6: 24,103,478 (GRCm39) V355A probably benign Het
St7 G A 6: 17,819,287 (GRCm39) V64M probably damaging Het
Tcf25 T A 8: 124,127,882 (GRCm39) L622* probably null Het
Tiam1 A G 16: 89,652,779 (GRCm39) V781A possibly damaging Het
Tigd2 C A 6: 59,187,562 (GRCm39) T143K probably benign Het
Tmem107 G T 11: 68,962,301 (GRCm39) probably null Het
Tmem161b G A 13: 84,399,359 (GRCm39) G5D probably damaging Het
Tonsl G A 15: 76,523,916 (GRCm39) A28V probably benign Het
Treml4 T C 17: 48,581,417 (GRCm39) Y222H probably damaging Het
Trp53bp1 A T 2: 121,087,131 (GRCm39) V175D probably damaging Het
Zfp184 T C 13: 22,144,072 (GRCm39) Y593H probably damaging Het
Zfp286 A G 11: 62,670,844 (GRCm39) C410R probably damaging Het
Zfp934 T G 13: 62,665,373 (GRCm39) N312H probably benign Het
Other mutations in Mpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Mpp3 APN 11 101,892,929 (GRCm39) missense possibly damaging 0.76
IGL01337:Mpp3 APN 11 101,891,411 (GRCm39) missense probably benign
IGL01393:Mpp3 APN 11 101,916,304 (GRCm39) missense probably damaging 0.99
IGL01544:Mpp3 APN 11 101,909,485 (GRCm39) missense possibly damaging 0.91
IGL02152:Mpp3 APN 11 101,916,216 (GRCm39) nonsense probably null
IGL02441:Mpp3 APN 11 101,900,501 (GRCm39) missense probably benign 0.00
IGL02656:Mpp3 APN 11 101,899,427 (GRCm39) missense probably benign
R0013:Mpp3 UTSW 11 101,896,251 (GRCm39) missense probably benign 0.27
R0117:Mpp3 UTSW 11 101,891,399 (GRCm39) missense probably damaging 1.00
R0564:Mpp3 UTSW 11 101,896,173 (GRCm39) missense possibly damaging 0.87
R1372:Mpp3 UTSW 11 101,891,401 (GRCm39) missense probably damaging 0.96
R1531:Mpp3 UTSW 11 101,899,475 (GRCm39) missense probably benign
R1639:Mpp3 UTSW 11 101,914,268 (GRCm39) missense probably damaging 1.00
R1720:Mpp3 UTSW 11 101,916,582 (GRCm39) start codon destroyed possibly damaging 0.79
R1968:Mpp3 UTSW 11 101,909,378 (GRCm39) intron probably benign
R2064:Mpp3 UTSW 11 101,891,516 (GRCm39) missense probably benign 0.01
R2363:Mpp3 UTSW 11 101,911,312 (GRCm39) missense probably damaging 1.00
R3775:Mpp3 UTSW 11 101,914,193 (GRCm39) nonsense probably null
R3776:Mpp3 UTSW 11 101,914,193 (GRCm39) nonsense probably null
R4208:Mpp3 UTSW 11 101,891,426 (GRCm39) missense probably benign
R4287:Mpp3 UTSW 11 101,914,289 (GRCm39) missense probably damaging 1.00
R4329:Mpp3 UTSW 11 101,914,337 (GRCm39) intron probably benign
R4367:Mpp3 UTSW 11 101,914,246 (GRCm39) missense probably benign 0.01
R4856:Mpp3 UTSW 11 101,915,962 (GRCm39) missense probably benign
R4886:Mpp3 UTSW 11 101,915,962 (GRCm39) missense probably benign
R4904:Mpp3 UTSW 11 101,891,413 (GRCm39) missense probably benign 0.01
R4946:Mpp3 UTSW 11 101,895,848 (GRCm39) missense probably benign 0.01
R5405:Mpp3 UTSW 11 101,901,047 (GRCm39) missense probably benign
R5935:Mpp3 UTSW 11 101,916,241 (GRCm39) missense probably damaging 1.00
R6020:Mpp3 UTSW 11 101,909,365 (GRCm39) intron probably benign
R6056:Mpp3 UTSW 11 101,902,515 (GRCm39) splice site probably null
R6151:Mpp3 UTSW 11 101,899,392 (GRCm39) missense probably benign 0.11
R6677:Mpp3 UTSW 11 101,899,444 (GRCm39) missense probably benign
R6784:Mpp3 UTSW 11 101,892,974 (GRCm39) critical splice acceptor site probably null
R6855:Mpp3 UTSW 11 101,904,151 (GRCm39) missense probably benign 0.09
R7227:Mpp3 UTSW 11 101,895,904 (GRCm39) missense possibly damaging 0.90
R7635:Mpp3 UTSW 11 101,916,209 (GRCm39) missense probably damaging 0.97
R7974:Mpp3 UTSW 11 101,899,180 (GRCm39) critical splice donor site probably null
R8330:Mpp3 UTSW 11 101,899,453 (GRCm39) missense probably benign 0.20
R8331:Mpp3 UTSW 11 101,902,541 (GRCm39) splice site probably null
R8993:Mpp3 UTSW 11 101,891,491 (GRCm39) missense probably benign 0.03
R9154:Mpp3 UTSW 11 101,911,328 (GRCm39) missense
R9593:Mpp3 UTSW 11 101,907,506 (GRCm39) missense possibly damaging 0.88
R9655:Mpp3 UTSW 11 101,899,481 (GRCm39) missense probably benign
Z1176:Mpp3 UTSW 11 101,899,182 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGGCTCCTTATTCTTCACCAAG -3'
(R):5'- TCTGTGCACAGTGATGAGCG -3'

Sequencing Primer
(F):5'- TATTCTTCACCAAGCGAACAATCTTC -3'
(R):5'- TCAGGGTAGTCACGCCACAG -3'
Posted On 2015-06-24