Incidental Mutation 'R4328:Crym'
ID324468
Institutional Source Beutler Lab
Gene Symbol Crym
Ensembl Gene ENSMUSG00000030905
Gene Namecrystallin, mu
Synonyms
MMRRC Submission 041098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4328 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120186380-120202111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120195339 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 219 (G219E)
Ref Sequence ENSEMBL: ENSMUSP00000033198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033198]
PDB Structure
Crystal structure of the apo form of mouse Mu-crystallin. [X-RAY DIFFRACTION]
Crystal structure of the NADPH form of mouse Mu-crystallin. [X-RAY DIFFRACTION]
Cristal structure of the NADPH-T3 form of mouse Mu-crystallin. [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000033198
AA Change: G219E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033198
Gene: ENSMUSG00000030905
AA Change: G219E

DomainStartEndE-ValueType
Pfam:OCD_Mu_crystall 3 313 7.1e-113 PFAM
Pfam:Shikimate_DH 124 227 7.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134067
Meta Mutation Damage Score 0.9585 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific and ubiquitous. The former class is also called phylogenetically-restricted crystallins. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. This gene encodes a taxon-specific crystallin protein that binds NADPH and has sequence similarity to bacterial ornithine cyclodeaminases. The encoded protein does not perform a structural role in lens tissue, and instead it binds thyroid hormone for possible regulatory or developmental roles. Mutations in this gene have been associated with autosomal dominant non-syndromic deafness. [provided by RefSeq, Sep 2014]
PHENOTYPE: At the euthyroid state, homozygotes display a normal growth curve, heart rate and hearing ability but have significantly reduced serum concentrations of triiodothyronine (T3) and thyroxine (T4). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik T C 9: 63,398,956 K89R probably damaging Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
9930021J03Rik G T 19: 29,743,561 T688K probably benign Het
Alcam T C 16: 52,253,216 N549S possibly damaging Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Bin3 A G 14: 70,118,605 I4V probably benign Het
Cd55 C T 1: 130,447,367 probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Col12a1 T A 9: 79,700,389 T386S possibly damaging Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Cwf19l2 A T 9: 3,458,878 I776F probably damaging Het
Erlec1 C T 11: 30,949,972 E166K probably benign Het
Fam129a T C 1: 151,636,418 S24P possibly damaging Het
Fam46b C T 4: 133,486,603 Q262* probably null Het
Gm13124 T A 4: 144,555,594 K209N possibly damaging Het
Gm3336 C T 8: 70,720,585 T82I probably benign Het
Gm3604 A T 13: 62,369,265 S425R possibly damaging Het
Gm6803 T A 12: 88,018,515 D86V possibly damaging Het
Gpn2 T C 4: 133,588,608 V203A probably benign Het
Gskip T C 12: 105,700,701 Y113H probably damaging Het
Hcn2 T C 10: 79,724,611 Y259H probably damaging Het
Hira C A 16: 18,896,612 Q87K probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kirrel T C 3: 87,084,774 probably benign Het
Klhl40 A G 9: 121,778,890 D372G probably benign Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Ly6e C A 15: 74,958,521 N73K probably damaging Het
Med12l T C 3: 59,265,267 S1813P probably benign Het
Med24 A G 11: 98,707,116 probably null Het
Nup210l C A 3: 90,175,835 probably null Het
Olfr1135 C A 2: 87,671,664 R234S possibly damaging Het
Olfr26 T C 9: 38,855,836 M258T possibly damaging Het
Olfr31 T A 14: 14,328,193 F27L probably damaging Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Pak3 T C X: 143,733,209 probably null Het
Palm G A 10: 79,807,686 G83S probably benign Het
Pax8 A G 2: 24,441,651 F140S possibly damaging Het
Ppargc1b A T 18: 61,382,469 C34* probably null Het
Ppp3cb A T 14: 20,530,948 I136K probably damaging Het
Prep T C 10: 45,120,649 V341A probably benign Het
Prickle4 C A 17: 47,688,618 G337C probably damaging Het
Rabgap1 T A 2: 37,532,615 Y627N probably damaging Het
Ryr1 T C 7: 29,083,059 Y1953C probably damaging Het
Snrnp200 T A 2: 127,222,217 V708D probably damaging Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem62 T A 2: 120,980,510 N156K probably damaging Het
Ttyh1 A T 7: 4,130,581 D295V probably damaging Het
Twsg1 T C 17: 65,948,738 T14A probably benign Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp239 T C 6: 117,871,784 L161P probably damaging Het
Zpbp2 A G 11: 98,557,606 T199A probably benign Het
Other mutations in Crym
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01562:Crym APN 7 120195399 missense probably damaging 0.98
IGL03355:Crym APN 7 120199313 splice site probably null
R0393:Crym UTSW 7 120189749 missense probably benign 0.00
R1538:Crym UTSW 7 120197715 missense probably benign 0.05
R2508:Crym UTSW 7 120201827 missense probably benign 0.08
R3836:Crym UTSW 7 120201216 missense probably benign 0.03
R4723:Crym UTSW 7 120201075 critical splice donor site probably null
R5046:Crym UTSW 7 120195444 missense possibly damaging 0.71
R5122:Crym UTSW 7 120195495 missense probably benign 0.00
R5266:Crym UTSW 7 120199294 missense probably benign 0.00
R5427:Crym UTSW 7 120199222 unclassified probably benign
R5567:Crym UTSW 7 120201893 missense probably benign 0.00
R5570:Crym UTSW 7 120201893 missense probably benign 0.00
R5704:Crym UTSW 7 120201940 splice site probably null
R6835:Crym UTSW 7 120186645 missense probably benign
R7274:Crym UTSW 7 120190519 missense probably benign 0.03
R7536:Crym UTSW 7 120201108 missense probably damaging 1.00
R8062:Crym UTSW 7 120201168 missense probably damaging 1.00
R8281:Crym UTSW 7 120202027 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GACACCCATCCTTTCGTAGC -3'
(R):5'- TGAGAATGTGGAACCGCAC -3'

Sequencing Primer
(F):5'- CAAGTTCTCTGTAAGTAGCCCAGG -3'
(R):5'- CCGCACCAGGGAAAATGCTG -3'
Posted On2015-06-24