Incidental Mutation 'R4328:Erlec1'
ID324481
Institutional Source Beutler Lab
Gene Symbol Erlec1
Ensembl Gene ENSMUSG00000020311
Gene Nameendoplasmic reticulum lectin 1
Synonyms4933407N01Rik
MMRRC Submission 041098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4328 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location30930774-30954335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30949972 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 166 (E166K)
Ref Sequence ENSEMBL: ENSMUSP00000072929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020551] [ENSMUST00000073192] [ENSMUST00000117883] [ENSMUST00000129593] [ENSMUST00000137306] [ENSMUST00000203878]
Predicted Effect probably benign
Transcript: ENSMUST00000020551
SMART Domains Protein: ENSMUSP00000020551
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
SOCS_box 460 502 2.1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073192
AA Change: E166K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072929
Gene: ENSMUSG00000020311
AA Change: E166K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:PRKCSH 111 199 6.6e-21 PFAM
Pfam:PRKCSH 342 421 2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117883
SMART Domains Protein: ENSMUSP00000113072
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129593
SMART Domains Protein: ENSMUSP00000129078
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
SCOP:d1c39a_ 2 52 1e-3 SMART
Pfam:PRKCSH 149 225 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137306
SMART Domains Protein: ENSMUSP00000114692
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 4.3e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143126
SMART Domains Protein: ENSMUSP00000126490
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
Pfam:PRKCSH 52 80 2.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155304
Predicted Effect probably benign
Transcript: ENSMUST00000203878
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Meta Mutation Damage Score 0.0725 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a resident endoplasmic reticulum (ER) protein that functions in N-glycan recognition. This protein is thought to be involved in ER-associated degradation via its interaction with the membrane-associated ubiquitin ligase complex. It also functions as a regulator of multiple cellular stress-response pathways in a manner that promotes metastatic cell survival. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 21. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik T C 9: 63,398,956 K89R probably damaging Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
9930021J03Rik G T 19: 29,743,561 T688K probably benign Het
Alcam T C 16: 52,253,216 N549S possibly damaging Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Bin3 A G 14: 70,118,605 I4V probably benign Het
Cd55 C T 1: 130,447,367 probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Col12a1 T A 9: 79,700,389 T386S possibly damaging Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Crym C T 7: 120,195,339 G219E probably damaging Het
Cwf19l2 A T 9: 3,458,878 I776F probably damaging Het
Fam129a T C 1: 151,636,418 S24P possibly damaging Het
Fam46b C T 4: 133,486,603 Q262* probably null Het
Gm13124 T A 4: 144,555,594 K209N possibly damaging Het
Gm3336 C T 8: 70,720,585 T82I probably benign Het
Gm3604 A T 13: 62,369,265 S425R possibly damaging Het
Gm6803 T A 12: 88,018,515 D86V possibly damaging Het
Gpn2 T C 4: 133,588,608 V203A probably benign Het
Gskip T C 12: 105,700,701 Y113H probably damaging Het
Hcn2 T C 10: 79,724,611 Y259H probably damaging Het
Hira C A 16: 18,896,612 Q87K probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kirrel T C 3: 87,084,774 probably benign Het
Klhl40 A G 9: 121,778,890 D372G probably benign Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Ly6e C A 15: 74,958,521 N73K probably damaging Het
Med12l T C 3: 59,265,267 S1813P probably benign Het
Med24 A G 11: 98,707,116 probably null Het
Nup210l C A 3: 90,175,835 probably null Het
Olfr1135 C A 2: 87,671,664 R234S possibly damaging Het
Olfr26 T C 9: 38,855,836 M258T possibly damaging Het
Olfr31 T A 14: 14,328,193 F27L probably damaging Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Pak3 T C X: 143,733,209 probably null Het
Palm G A 10: 79,807,686 G83S probably benign Het
Pax8 A G 2: 24,441,651 F140S possibly damaging Het
Ppargc1b A T 18: 61,382,469 C34* probably null Het
Ppp3cb A T 14: 20,530,948 I136K probably damaging Het
Prep T C 10: 45,120,649 V341A probably benign Het
Prickle4 C A 17: 47,688,618 G337C probably damaging Het
Rabgap1 T A 2: 37,532,615 Y627N probably damaging Het
Ryr1 T C 7: 29,083,059 Y1953C probably damaging Het
Snrnp200 T A 2: 127,222,217 V708D probably damaging Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem62 T A 2: 120,980,510 N156K probably damaging Het
Ttyh1 A T 7: 4,130,581 D295V probably damaging Het
Twsg1 T C 17: 65,948,738 T14A probably benign Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp239 T C 6: 117,871,784 L161P probably damaging Het
Zpbp2 A G 11: 98,557,606 T199A probably benign Het
Other mutations in Erlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Erlec1 APN 11 30948510 missense possibly damaging 0.84
IGL00537:Erlec1 APN 11 30939591 missense probably benign 0.04
IGL00766:Erlec1 APN 11 30950623 nonsense probably null
IGL01760:Erlec1 APN 11 30934731 missense probably benign 0.34
IGL02505:Erlec1 APN 11 30950767 missense probably damaging 1.00
IGL02633:Erlec1 APN 11 30948430 nonsense probably null
R0674:Erlec1 UTSW 11 30935073 intron probably benign
R1211:Erlec1 UTSW 11 30948298 critical splice donor site probably null
R1974:Erlec1 UTSW 11 30939604 missense possibly damaging 0.83
R4326:Erlec1 UTSW 11 30949972 missense probably benign
R4392:Erlec1 UTSW 11 30943697 critical splice donor site probably null
R4641:Erlec1 UTSW 11 30948442 nonsense probably null
R4697:Erlec1 UTSW 11 30952640 missense probably benign 0.27
R4917:Erlec1 UTSW 11 30934710 missense possibly damaging 0.56
R5486:Erlec1 UTSW 11 30935047 missense probably damaging 0.98
R5735:Erlec1 UTSW 11 30950591 missense probably benign 0.00
R5775:Erlec1 UTSW 11 30943848 missense probably benign 0.11
R6475:Erlec1 UTSW 11 30948442 nonsense probably null
R7027:Erlec1 UTSW 11 30950790 missense probably damaging 1.00
R7235:Erlec1 UTSW 11 30950751 missense possibly damaging 0.91
R7440:Erlec1 UTSW 11 30950818 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGCTAGACACTGTTCTATTTCTGG -3'
(R):5'- TGCTGGCTCCAATACCCAAC -3'

Sequencing Primer
(F):5'- AATATGTGAGCCATCGTGCC -3'
(R):5'- TGGCTCCAATACCCAACAACCC -3'
Posted On2015-06-24