Incidental Mutation 'R4328:Gm3604'
ID324489
Institutional Source Beutler Lab
Gene Symbol Gm3604
Ensembl Gene ENSMUSG00000094942
Gene Namepredicted gene 3604
Synonyms
MMRRC Submission 041098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R4328 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location62368328-62383177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62369265 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 425 (S425R)
Ref Sequence ENSEMBL: ENSMUSP00000103623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107989] [ENSMUST00000187656] [ENSMUST00000202194]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107989
AA Change: S425R

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103623
Gene: ENSMUSG00000094942
AA Change: S425R

DomainStartEndE-ValueType
KRAB 3 65 4.49e-17 SMART
ZnF_C2H2 132 154 2.71e-2 SMART
ZnF_C2H2 160 182 1.3e-4 SMART
ZnF_C2H2 188 210 5.21e-4 SMART
ZnF_C2H2 216 238 1.82e-3 SMART
ZnF_C2H2 244 266 7.78e-3 SMART
ZnF_C2H2 272 294 3.69e-4 SMART
ZnF_C2H2 300 322 3.95e-4 SMART
ZnF_C2H2 328 350 9.08e-4 SMART
ZnF_C2H2 356 378 1.45e-2 SMART
ZnF_C2H2 384 406 1.92e-2 SMART
ZnF_C2H2 412 434 1.3e-4 SMART
ZnF_C2H2 440 462 4.87e-4 SMART
ZnF_C2H2 468 490 1.4e-4 SMART
ZnF_C2H2 496 518 3.95e-4 SMART
ZnF_C2H2 524 546 2.29e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187656
AA Change: S426R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139845
Gene: ENSMUSG00000094942
AA Change: S426R

DomainStartEndE-ValueType
KRAB 4 66 1.9e-19 SMART
ZnF_C2H2 133 155 1.2e-4 SMART
ZnF_C2H2 161 183 5.5e-7 SMART
ZnF_C2H2 189 211 2.3e-6 SMART
ZnF_C2H2 217 239 7.5e-6 SMART
ZnF_C2H2 245 267 3.4e-5 SMART
ZnF_C2H2 273 295 1.5e-6 SMART
ZnF_C2H2 301 323 1.7e-6 SMART
ZnF_C2H2 329 351 3.7e-6 SMART
ZnF_C2H2 357 379 6.3e-5 SMART
ZnF_C2H2 385 407 7.8e-5 SMART
ZnF_C2H2 413 435 5.5e-7 SMART
ZnF_C2H2 441 463 2e-6 SMART
ZnF_C2H2 469 491 5.8e-7 SMART
ZnF_C2H2 497 519 1.6e-6 SMART
ZnF_C2H2 525 547 9.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202194
SMART Domains Protein: ENSMUSP00000144048
Gene: ENSMUSG00000094942

DomainStartEndE-ValueType
KRAB 4 65 1.2e-19 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik T C 9: 63,398,956 K89R probably damaging Het
3110043O21Rik T A 4: 35,225,985 probably benign Het
9930021J03Rik G T 19: 29,743,561 T688K probably benign Het
Alcam T C 16: 52,253,216 N549S possibly damaging Het
Arap2 A T 5: 62,621,863 H1461Q possibly damaging Het
Bin3 A G 14: 70,118,605 I4V probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Cd55 C T 1: 130,447,367 probably benign Het
Col12a1 T A 9: 79,700,389 T386S possibly damaging Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Crym C T 7: 120,195,339 G219E probably damaging Het
Cwf19l2 A T 9: 3,458,878 I776F probably damaging Het
Erlec1 C T 11: 30,949,972 E166K probably benign Het
Fam129a T C 1: 151,636,418 S24P possibly damaging Het
Fam46b C T 4: 133,486,603 Q262* probably null Het
Gm13124 T A 4: 144,555,594 K209N possibly damaging Het
Gm3336 C T 8: 70,720,585 T82I probably benign Het
Gm6803 T A 12: 88,018,515 D86V possibly damaging Het
Gpn2 T C 4: 133,588,608 V203A probably benign Het
Gskip T C 12: 105,700,701 Y113H probably damaging Het
Hcn2 T C 10: 79,724,611 Y259H probably damaging Het
Hira C A 16: 18,896,612 Q87K probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kirrel T C 3: 87,084,774 probably benign Het
Klhl40 A G 9: 121,778,890 D372G probably benign Het
Lingo2 T A 4: 35,708,462 D506V probably damaging Het
Ly6e C A 15: 74,958,521 N73K probably damaging Het
Med12l T C 3: 59,265,267 S1813P probably benign Het
Med24 A G 11: 98,707,116 probably null Het
Nup210l C A 3: 90,175,835 probably null Het
Olfr1135 C A 2: 87,671,664 R234S possibly damaging Het
Olfr26 T C 9: 38,855,836 M258T possibly damaging Het
Olfr31 T A 14: 14,328,193 F27L probably damaging Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pafah1b1 T C 11: 74,682,240 T333A probably benign Het
Pak3 T C X: 143,733,209 probably null Het
Palm G A 10: 79,807,686 G83S probably benign Het
Pax8 A G 2: 24,441,651 F140S possibly damaging Het
Ppargc1b A T 18: 61,382,469 C34* probably null Het
Ppp3cb A T 14: 20,530,948 I136K probably damaging Het
Prep T C 10: 45,120,649 V341A probably benign Het
Prickle4 C A 17: 47,688,618 G337C probably damaging Het
Rabgap1 T A 2: 37,532,615 Y627N probably damaging Het
Ryr1 T C 7: 29,083,059 Y1953C probably damaging Het
Snrnp200 T A 2: 127,222,217 V708D probably damaging Het
Tmem107 G T 11: 69,071,475 probably null Het
Tmem62 T A 2: 120,980,510 N156K probably damaging Het
Ttyh1 A T 7: 4,130,581 D295V probably damaging Het
Twsg1 T C 17: 65,948,738 T14A probably benign Het
Zfp184 T C 13: 21,959,902 Y593H probably damaging Het
Zfp239 T C 6: 117,871,784 L161P probably damaging Het
Zpbp2 A G 11: 98,557,606 T199A probably benign Het
Other mutations in Gm3604
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Gm3604 APN 13 62370140 missense probably damaging 1.00
IGL02601:Gm3604 APN 13 62370176 missense possibly damaging 0.79
IGL03386:Gm3604 APN 13 62370167 missense possibly damaging 0.95
R1539:Gm3604 UTSW 13 62371600 missense possibly damaging 0.70
R1771:Gm3604 UTSW 13 62370074 nonsense probably null
R1776:Gm3604 UTSW 13 62370074 nonsense probably null
R1919:Gm3604 UTSW 13 62369942 missense probably benign 0.02
R1954:Gm3604 UTSW 13 62369211 missense probably damaging 0.97
R2093:Gm3604 UTSW 13 62369606 missense possibly damaging 0.50
R2291:Gm3604 UTSW 13 62371843 missense probably damaging 0.99
R2909:Gm3604 UTSW 13 62369018 missense probably benign 0.43
R3195:Gm3604 UTSW 13 62370054 nonsense probably null
R3196:Gm3604 UTSW 13 62370054 nonsense probably null
R3924:Gm3604 UTSW 13 62370230 missense probably damaging 0.99
R4543:Gm3604 UTSW 13 62370156 missense probably benign
R4830:Gm3604 UTSW 13 62369043 missense probably damaging 0.98
R5129:Gm3604 UTSW 13 62369774 missense probably benign 0.00
R5496:Gm3604 UTSW 13 62371579 missense possibly damaging 0.85
R6184:Gm3604 UTSW 13 62371845 missense probably damaging 1.00
R6426:Gm3604 UTSW 13 62369622 missense probably damaging 1.00
R6925:Gm3604 UTSW 13 62369390 missense probably benign 0.16
R7080:Gm3604 UTSW 13 62370295 missense probably damaging 1.00
R7182:Gm3604 UTSW 13 62371875 missense probably damaging 0.99
R7572:Gm3604 UTSW 13 62370246 missense probably damaging 1.00
R7750:Gm3604 UTSW 13 62369996 missense possibly damaging 0.92
R8023:Gm3604 UTSW 13 62369869 missense probably damaging 1.00
R8062:Gm3604 UTSW 13 62370341 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTTGCTCACAATGAAATTCC -3'
(R):5'- AAGCCTTTTCCCAATACAGTCATC -3'

Sequencing Primer
(F):5'- TGGTGAGAAAAGCCTTCATCAC -3'
(R):5'- TACAGTCATCTCCACATTCATAGAAG -3'
Posted On2015-06-24