Mutagenetix > Incidental Mutations

Incidental Mutation 'R4329:Dnah7c'

324499

Institutional Source

Beutler Lab

Gene Symbol

Dnah7c

Ensembl Gene

ENSMUSG00000101337

Gene Name

dynein, axonemal, heavy chain 7C

Synonyms

Dnahc7c

MMRRC Submission

041663-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.371) question?

Stock #

R4329 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46425592-46807476 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46649281 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1870 (D1870E)

Ref Sequence

ENSEMBL: ENSMUSP00000140430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000189749]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189339

Predicted Effect

probably benign
Transcript: ENSMUST00000189749
AA Change: D1870E

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: D1870E

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	37	48	N/A	INTRINSIC
coiled coil region	714	746	N/A	INTRINSIC
Pfam:DHC_N2	754	1167	2.2e-138	PFAM
AAA	1320	1459	4e-3	SMART
Blast:AAA	1601	1829	4e-87	BLAST
AAA	1968	2116	8.7e-4	SMART
Pfam:AAA_8	2303	2574	6.2e-73	PFAM
Pfam:MT	2586	2935	5.4e-52	PFAM
Pfam:AAA_9	2953	3183	7.4e-63	PFAM
Pfam:Dynein_heavy	3312	4021	1.3e-250	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191499

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

96% (68/71)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	A	G	19: 7,421,226		probably benign	Het
2900026A02Rik	C	A	5: 113,095,589		probably null	Het
9930021J03Rik	G	T	19: 29,743,561	T688K	probably benign	Het
Adamts15	T	C	9: 30,904,518	S681G	probably benign	Het
Ampd2	C	A	3: 108,077,787		probably benign	Het
Ang2	A	T	14: 51,195,868	I19N	possibly damaging	Het
Cacna1s	A	C	1: 136,119,033	D1819A	probably benign	Het
Cand2	C	A	6: 115,799,988	H1112Q	possibly damaging	Het
Catsperd	T	A	17: 56,654,517	I413K	possibly damaging	Het
Ccdc142	T	A	6: 83,107,016		probably benign	Het
Cd55	A	T	1: 130,452,483	C253S	probably damaging	Het
Celsr3	C	T	9: 108,846,049	R2847C	probably benign	Het
Cep290	C	T	10: 100,537,668	S1270L	probably damaging	Het
Chka	T	C	19: 3,875,803		probably benign	Het
Cntnap5b	T	A	1: 100,072,163	D215E	probably damaging	Het
Col13a1	T	C	10: 61,863,979	T476A	unknown	Het
Cspg4	T	C	9: 56,892,465	F1539L	probably damaging	Het
Cwf19l2	A	T	9: 3,458,878	I776F	probably damaging	Het
Dchs1	A	T	7: 105,753,759	I3192N	probably damaging	Het
Drc1	A	T	5: 30,355,658	I359L	probably benign	Het
Esp1	A	G	17: 40,728,877	M18V	probably benign	Het
Exoc1	T	A	5: 76,567,975	F789L	probably damaging	Het
Fbxw22	T	A	9: 109,384,043	T279S	probably damaging	Het
Frem1	G	A	4: 82,986,537	A880V	probably benign	Het
Gm29514	A	G	1: 146,420,691		noncoding transcript	Het
Grm7	T	C	6: 110,914,364	L186P	probably damaging	Het
Ipo8	A	T	6: 148,800,164		probably benign	Het
Klk4	A	G	7: 43,884,406	D202G	probably damaging	Het
March6	C	T	15: 31,498,741	E137K	probably benign	Het
Mpp3	T	C	11: 102,023,511		probably benign	Het
Mroh2b	T	A	15: 4,931,379	Y808N	probably damaging	Het
Myom1	C	T	17: 71,036,353	L182F	probably damaging	Het
Nova1	A	T	12: 46,720,832	I102N	unknown	Het
Olfr854	T	A	9: 19,567,022	M121L	possibly damaging	Het
Pak3	T	C	X: 143,733,209		probably null	Het
Palm	G	A	10: 79,807,686	G83S	probably benign	Het
Patl2	C	T	2: 122,127,537	S80N	probably benign	Het
Pcdhb9	A	T	18: 37,401,822	S290C	probably benign	Het
Pcdhb9	G	T	18: 37,401,823	S290I	probably benign	Het
Pdgfrb	A	T	18: 61,071,720	I551F	possibly damaging	Het
Pkmyt1	T	A	17: 23,732,735	Y88N	probably damaging	Het
Pnkp	T	C	7: 44,858,594	S114P	probably benign	Het
Rdm1	T	A	11: 101,630,908	V92E	probably damaging	Het
Sema4d	T	C	13: 51,703,304	R631G	probably benign	Het
Sin3a	T	C	9: 57,095,358	L178P	probably damaging	Het
Skint9	A	C	4: 112,391,865	L122R	probably damaging	Het
Slc16a13	T	C	11: 70,217,897	N369S	probably benign	Het
Strada	A	G	11: 106,187,173		probably benign	Het
Tnxb	C	A	17: 34,693,864	S1784Y	probably damaging	Het
Trpc2	T	C	7: 102,087,520	V318A	probably damaging	Het
Ttc3	G	A	16: 94,466,961	R1589H	probably damaging	Het
Ttyh1	A	T	7: 4,130,581	D295V	probably damaging	Het
Unc5b	A	G	10: 60,783,190	Y58H	probably damaging	Het
Xylt1	G	A	7: 117,656,461	G752D	probably damaging	Het
Yipf7	A	T	5: 69,521,122	L55Q	probably damaging	Het
Zfp827	G	A	8: 79,189,834		probably benign	Het

Other mutations in Dnah7c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00559:Dnah7c	APN	1	46807289	missense	possibly damaging	0.72
IGL02958:Dnah7c	APN	1	46657111	missense	probably damaging	1.00
IGL03035:Dnah7c	APN	1	46524117	missense	probably benign	0.37
IGL03161:Dnah7c	APN	1	46467296	missense	probably benign	0.20
IGL03178:Dnah7c	APN	1	46467365	missense	probably benign
IGL03052:Dnah7c	UTSW	1	46632149	missense	probably damaging	1.00
R0751:Dnah7c	UTSW	1	46465905	missense	probably benign
R1029:Dnah7c	UTSW	1	46612721	missense	probably damaging	1.00
R3104:Dnah7c	UTSW	1	46798279	missense	probably damaging	0.97
R3977:Dnah7c	UTSW	1	46628911	missense	possibly damaging	0.75
R4003:Dnah7c	UTSW	1	46681817	missense	probably damaging	1.00
R4133:Dnah7c	UTSW	1	46665990	missense	probably benign	0.01
R4303:Dnah7c	UTSW	1	46748578	missense	probably damaging	1.00
R4434:Dnah7c	UTSW	1	46666282	missense	probably damaging	1.00
R4457:Dnah7c	UTSW	1	46740621	missense	probably damaging	1.00
R4470:Dnah7c	UTSW	1	46748635	missense	possibly damaging	0.56
R4507:Dnah7c	UTSW	1	46766611	missense	probably damaging	1.00
R4527:Dnah7c	UTSW	1	46532931	missense	probably benign	0.34
R4571:Dnah7c	UTSW	1	46533216	missense	probably damaging	0.99
R4589:Dnah7c	UTSW	1	46514583	nonsense	probably null
R4731:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4732:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4733:Dnah7c	UTSW	1	46770173	missense	probably damaging	1.00
R4747:Dnah7c	UTSW	1	46533168	missense	probably damaging	1.00
R4845:Dnah7c	UTSW	1	46793532	missense	probably damaging	1.00
R4873:Dnah7c	UTSW	1	46688925	missense	probably benign
R4875:Dnah7c	UTSW	1	46688925	missense	probably benign
R4916:Dnah7c	UTSW	1	46595008	missense	probably damaging	1.00
R5241:Dnah7c	UTSW	1	46530500	missense	probably benign
R5279:Dnah7c	UTSW	1	46519269	missense	probably benign	0.14
R5327:Dnah7c	UTSW	1	46665568	missense	probably benign	0.05
R5546:Dnah7c	UTSW	1	46666317	missense	probably damaging	1.00
R5605:Dnah7c	UTSW	1	46798235	missense	possibly damaging	0.84
R5637:Dnah7c	UTSW	1	46760361	splice site	probably null
R5639:Dnah7c	UTSW	1	46739668	missense	probably benign
R5663:Dnah7c	UTSW	1	46535148	missense	probably damaging	1.00
R5718:Dnah7c	UTSW	1	46748666	missense	possibly damaging	0.47
R5759:Dnah7c	UTSW	1	46615367	missense	probably damaging	1.00
R5771:Dnah7c	UTSW	1	46639665	missense	probably benign	0.00
R5784:Dnah7c	UTSW	1	46524068	missense	possibly damaging	0.80
R5800:Dnah7c	UTSW	1	46647015	missense	probably benign	0.01
R5933:Dnah7c	UTSW	1	46519215	missense	probably damaging	1.00
R5948:Dnah7c	UTSW	1	46672497	missense	probably benign	0.21
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6034:Dnah7c	UTSW	1	46457258	missense	probably benign	0.00
R6487:Dnah7c	UTSW	1	46769124	missense	probably damaging	1.00
R6536:Dnah7c	UTSW	1	46658290	missense	probably benign	0.00
R6614:Dnah7c	UTSW	1	46649340	missense	probably benign
R6614:Dnah7c	UTSW	1	46649351	missense	probably benign
R6615:Dnah7c	UTSW	1	46515439	missense	probably benign	0.01
R6615:Dnah7c	UTSW	1	46649340	missense	probably benign
R6615:Dnah7c	UTSW	1	46649351	missense	probably benign
R6649:Dnah7c	UTSW	1	46649340	missense	probably benign
R6649:Dnah7c	UTSW	1	46649351	missense	probably benign
R6650:Dnah7c	UTSW	1	46649340	missense	probably benign
R6650:Dnah7c	UTSW	1	46649351	missense	probably benign
R6651:Dnah7c	UTSW	1	46649340	missense	probably benign
R6651:Dnah7c	UTSW	1	46649351	missense	probably benign
R6653:Dnah7c	UTSW	1	46649340	missense	probably benign
R6653:Dnah7c	UTSW	1	46649351	missense	probably benign
R6714:Dnah7c	UTSW	1	46740806	missense	probably damaging	0.99
R6729:Dnah7c	UTSW	1	46672521	missense	possibly damaging	0.46
R6760:Dnah7c	UTSW	1	46649340	missense	probably benign
R6760:Dnah7c	UTSW	1	46649351	missense	probably benign
R6763:Dnah7c	UTSW	1	46628890	missense	possibly damaging	0.60
R6866:Dnah7c	UTSW	1	46657243	missense	probably damaging	1.00
R6880:Dnah7c	UTSW	1	46527671	missense	probably damaging	0.97
R6988:Dnah7c	UTSW	1	46666213	missense	possibly damaging	0.68
R6995:Dnah7c	UTSW	1	46455813	missense	probably benign	0.07
R7007:Dnah7c	UTSW	1	46532750	missense	probably benign	0.04
R7086:Dnah7c	UTSW	1	46750125	missense	probably benign	0.00
R7128:Dnah7c	UTSW	1	46527485	missense	probably benign
R7131:Dnah7c	UTSW	1	46681772	missense	probably benign	0.00
R7135:Dnah7c	UTSW	1	46533208	missense	probably damaging	1.00
R7171:Dnah7c	UTSW	1	46680738	missense	probably damaging	0.99
R7176:Dnah7c	UTSW	1	46430809	missense	probably benign	0.00
R7221:Dnah7c	UTSW	1	46455777	missense	possibly damaging	0.87
R7310:Dnah7c	UTSW	1	46596967	missense	possibly damaging	0.94
R7319:Dnah7c	UTSW	1	46780775	missense	probably benign	0.31
R7319:Dnah7c	UTSW	1	46784448	missense	possibly damaging	0.95
R7404:Dnah7c	UTSW	1	46666063	missense	possibly damaging	0.52
R7452:Dnah7c	UTSW	1	46647036	missense	possibly damaging	0.91
R7515:Dnah7c	UTSW	1	46457290	missense	probably benign
R7534:Dnah7c	UTSW	1	46770067	missense	probably damaging	0.98
R7542:Dnah7c	UTSW	1	46784498	missense	probably benign	0.00
R7605:Dnah7c	UTSW	1	46632310	missense	probably damaging	1.00
R7643:Dnah7c	UTSW	1	46602813	missense	probably benign
R7770:Dnah7c	UTSW	1	46626300	splice site	probably null
R7884:Dnah7c	UTSW	1	46791769	missense	probably benign	0.23
R7899:Dnah7c	UTSW	1	46514701	missense	probably benign	0.00
R8025:Dnah7c	UTSW	1	46457296	missense	probably benign	0.01
R8057:Dnah7c	UTSW	1	46688952	missense	possibly damaging	0.52
R8191:Dnah7c	UTSW	1	46607458	missense	possibly damaging	0.56
R8255:Dnah7c	UTSW	1	46659429	missense	probably damaging	1.00
R8428:Dnah7c	UTSW	1	46672376	missense	probably damaging	1.00
R8441:Dnah7c	UTSW	1	46533238	missense	probably damaging	1.00
R8485:Dnah7c	UTSW	1	46680792	missense	probably benign	0.05
R8559:Dnah7c	UTSW	1	46725139	missense	probably damaging	1.00
R8752:Dnah7c	UTSW	1	46672541	missense	probably benign	0.00
R8869:Dnah7c	UTSW	1	46632344	missense	probably damaging	0.97
R9058:Dnah7c	UTSW	1	46766656	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46665490	missense	probably damaging	0.97
R9121:Dnah7c	UTSW	1	46777736	missense	probably benign	0.00
R9246:Dnah7c	UTSW	1	46532774	missense	possibly damaging	0.51
R9319:Dnah7c	UTSW	1	46482008	missense	possibly damaging	0.94
R9388:Dnah7c	UTSW	1	46740726	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46467302	missense	probably benign	0.00
Z1176:Dnah7c	UTSW	1	46615281	missense	probably damaging	1.00
Z1176:Dnah7c	UTSW	1	46639665	missense	probably benign
Z1176:Dnah7c	UTSW	1	46646992	critical splice acceptor site	probably null
Z1176:Dnah7c	UTSW	1	46760316	missense	possibly damaging	0.95
Z1177:Dnah7c	UTSW	1	46654103	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ACCTGCTGTTGCACCATAGC -3'
(R):5'- ACATGCTCTGTCTCACCAGG -3'

Sequencing Primer
(F):5'- GCTGTTGCACCATAGCTCATG -3'
(R):5'- AGGCTGGCAGTTACACATC -3'

Posted On

2015-06-24