Incidental Mutation 'R4329:Patl2'
ID324506
Institutional Source Beutler Lab
Gene Symbol Patl2
Ensembl Gene ENSMUSG00000027233
Gene Nameprotein associated with topoisomerase II homolog 2 (yeast)
SynonymsPat1a, 4930424G05Rik
MMRRC Submission 041663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4329 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122120108-122186189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122127537 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 80 (S80N)
Ref Sequence ENSEMBL: ENSMUSP00000028665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028665]
Predicted Effect probably benign
Transcript: ENSMUST00000028665
AA Change: S80N

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233
AA Change: S80N

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:PAT1 247 490 6.7e-12 PFAM
Meta Mutation Damage Score 0.1333 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 96% (68/71)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
2900026A02Rik C A 5: 113,095,589 probably null Het
9930021J03Rik G T 19: 29,743,561 T688K probably benign Het
Adamts15 T C 9: 30,904,518 S681G probably benign Het
Ampd2 C A 3: 108,077,787 probably benign Het
Ang2 A T 14: 51,195,868 I19N possibly damaging Het
Cacna1s A C 1: 136,119,033 D1819A probably benign Het
Cand2 C A 6: 115,799,988 H1112Q possibly damaging Het
Catsperd T A 17: 56,654,517 I413K possibly damaging Het
Ccdc142 T A 6: 83,107,016 probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Celsr3 C T 9: 108,846,049 R2847C probably benign Het
Cep290 C T 10: 100,537,668 S1270L probably damaging Het
Chka T C 19: 3,875,803 probably benign Het
Cntnap5b T A 1: 100,072,163 D215E probably damaging Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Cspg4 T C 9: 56,892,465 F1539L probably damaging Het
Cwf19l2 A T 9: 3,458,878 I776F probably damaging Het
Dchs1 A T 7: 105,753,759 I3192N probably damaging Het
Dnah7c T A 1: 46,649,281 D1870E probably benign Het
Drc1 A T 5: 30,355,658 I359L probably benign Het
Esp1 A G 17: 40,728,877 M18V probably benign Het
Exoc1 T A 5: 76,567,975 F789L probably damaging Het
Fbxw22 T A 9: 109,384,043 T279S probably damaging Het
Frem1 G A 4: 82,986,537 A880V probably benign Het
Gm29514 A G 1: 146,420,691 noncoding transcript Het
Grm7 T C 6: 110,914,364 L186P probably damaging Het
Ipo8 A T 6: 148,800,164 probably benign Het
Klk4 A G 7: 43,884,406 D202G probably damaging Het
March6 C T 15: 31,498,741 E137K probably benign Het
Mpp3 T C 11: 102,023,511 probably benign Het
Mroh2b T A 15: 4,931,379 Y808N probably damaging Het
Myom1 C T 17: 71,036,353 L182F probably damaging Het
Nova1 A T 12: 46,720,832 I102N unknown Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Palm G A 10: 79,807,686 G83S probably benign Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Pdgfrb A T 18: 61,071,720 I551F possibly damaging Het
Pkmyt1 T A 17: 23,732,735 Y88N probably damaging Het
Pnkp T C 7: 44,858,594 S114P probably benign Het
Rdm1 T A 11: 101,630,908 V92E probably damaging Het
Sema4d T C 13: 51,703,304 R631G probably benign Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Skint9 A C 4: 112,391,865 L122R probably damaging Het
Slc16a13 T C 11: 70,217,897 N369S probably benign Het
Strada A G 11: 106,187,173 probably benign Het
Tnxb C A 17: 34,693,864 S1784Y probably damaging Het
Trpc2 T C 7: 102,087,520 V318A probably damaging Het
Ttc3 G A 16: 94,466,961 R1589H probably damaging Het
Ttyh1 A T 7: 4,130,581 D295V probably damaging Het
Unc5b A G 10: 60,783,190 Y58H probably damaging Het
Xylt1 G A 7: 117,656,461 G752D probably damaging Het
Yipf7 A T 5: 69,521,122 L55Q probably damaging Het
Zfp827 G A 8: 79,189,834 probably benign Het
Other mutations in Patl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Patl2 APN 2 122123810 missense probably benign 0.19
IGL01780:Patl2 APN 2 122121846 missense probably damaging 1.00
IGL02604:Patl2 APN 2 122125333 missense possibly damaging 0.80
IGL02713:Patl2 APN 2 122125847 missense probably benign 0.01
IGL02990:Patl2 APN 2 122124497 critical splice acceptor site probably null
FR4304:Patl2 UTSW 2 122126135 small insertion probably benign
FR4548:Patl2 UTSW 2 122126135 small insertion probably benign
FR4737:Patl2 UTSW 2 122126136 small insertion probably benign
FR4737:Patl2 UTSW 2 122126144 nonsense probably null
FR4737:Patl2 UTSW 2 122126145 small insertion probably benign
FR4976:Patl2 UTSW 2 122126139 small insertion probably benign
FR4976:Patl2 UTSW 2 122126141 small insertion probably benign
FR4976:Patl2 UTSW 2 122126144 small insertion probably benign
FR4976:Patl2 UTSW 2 122126145 small insertion probably benign
R0001:Patl2 UTSW 2 122125710 splice site probably benign
R0002:Patl2 UTSW 2 122125710 splice site probably benign
R0540:Patl2 UTSW 2 122126669 missense probably benign
R0570:Patl2 UTSW 2 122125308 missense probably damaging 0.99
R0607:Patl2 UTSW 2 122126669 missense probably benign
R1463:Patl2 UTSW 2 122123735 missense probably benign 0.38
R2992:Patl2 UTSW 2 122125754 missense probably damaging 0.97
R4583:Patl2 UTSW 2 122126745 missense probably benign 0.00
R4737:Patl2 UTSW 2 122125306 missense probably damaging 1.00
R4965:Patl2 UTSW 2 122128848 nonsense probably null
R5091:Patl2 UTSW 2 122123802 missense probably benign 0.01
R5256:Patl2 UTSW 2 122128887 missense probably damaging 1.00
R5450:Patl2 UTSW 2 122125281 missense probably benign 0.00
R5990:Patl2 UTSW 2 122124484 missense probably damaging 1.00
R6028:Patl2 UTSW 2 122126137 missense possibly damaging 0.76
R6107:Patl2 UTSW 2 122127486 missense probably damaging 0.98
R6597:Patl2 UTSW 2 122186164 start gained probably benign
R6969:Patl2 UTSW 2 122128929 missense possibly damaging 0.52
R7131:Patl2 UTSW 2 122121782 critical splice donor site probably null
R7436:Patl2 UTSW 2 122127525 missense probably benign 0.00
R7718:Patl2 UTSW 2 122126774 intron probably null
R7852:Patl2 UTSW 2 122179109 unclassified probably benign
R8397:Patl2 UTSW 2 122125273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGCACCCCATACCAATG -3'
(R):5'- CATGCAGTTACTGTCCTGGC -3'

Sequencing Primer
(F):5'- TTCTTCATCTCCAGGGCAAGAAG -3'
(R):5'- CAGTTACTGTCCTGGCTGTTGAAATG -3'
Posted On2015-06-24