Incidental Mutation 'R4329:Exoc1'
ID324512
Institutional Source Beutler Lab
Gene Symbol Exoc1
Ensembl Gene ENSMUSG00000036435
Gene Nameexocyst complex component 1
Synonyms2810407P21Rik, Sec3p, SEC3, A730011E05Rik, Sec3l1
MMRRC Submission 041663-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4329 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76529311-76570294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76567975 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 789 (F789L)
Ref Sequence ENSEMBL: ENSMUSP00000109121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049469] [ENSMUST00000087133] [ENSMUST00000113493] [ENSMUST00000134521]
Predicted Effect probably damaging
Transcript: ENSMUST00000049469
AA Change: F767L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046719
Gene: ENSMUSG00000036435
AA Change: F767L

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 856 5.5e-221 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087133
AA Change: F782L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084373
Gene: ENSMUSG00000036435
AA Change: F782L

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 871 2e-220 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113493
AA Change: F789L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109121
Gene: ENSMUSG00000036435
AA Change: F789L

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
coiled coil region 161 183 N/A INTRINSIC
Pfam:Sec3_C 190 878 4.1e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132807
Predicted Effect probably benign
Transcript: ENSMUST00000134521
SMART Domains Protein: ENSMUSP00000121784
Gene: ENSMUSG00000036435

DomainStartEndE-ValueType
Pfam:Sec3_C 1 111 1.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143736
Meta Mutation Damage Score 0.7777 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 96% (68/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
2900026A02Rik C A 5: 113,095,589 probably null Het
9930021J03Rik G T 19: 29,743,561 T688K probably benign Het
Adamts15 T C 9: 30,904,518 S681G probably benign Het
Ampd2 C A 3: 108,077,787 probably benign Het
Ang2 A T 14: 51,195,868 I19N possibly damaging Het
Cacna1s A C 1: 136,119,033 D1819A probably benign Het
Cand2 C A 6: 115,799,988 H1112Q possibly damaging Het
Catsperd T A 17: 56,654,517 I413K possibly damaging Het
Ccdc142 T A 6: 83,107,016 probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Celsr3 C T 9: 108,846,049 R2847C probably benign Het
Cep290 C T 10: 100,537,668 S1270L probably damaging Het
Chka T C 19: 3,875,803 probably benign Het
Cntnap5b T A 1: 100,072,163 D215E probably damaging Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Cspg4 T C 9: 56,892,465 F1539L probably damaging Het
Cwf19l2 A T 9: 3,458,878 I776F probably damaging Het
Dchs1 A T 7: 105,753,759 I3192N probably damaging Het
Dnah7c T A 1: 46,649,281 D1870E probably benign Het
Drc1 A T 5: 30,355,658 I359L probably benign Het
Esp1 A G 17: 40,728,877 M18V probably benign Het
Fbxw22 T A 9: 109,384,043 T279S probably damaging Het
Frem1 G A 4: 82,986,537 A880V probably benign Het
Gm29514 A G 1: 146,420,691 noncoding transcript Het
Grm7 T C 6: 110,914,364 L186P probably damaging Het
Ipo8 A T 6: 148,800,164 probably benign Het
Klk4 A G 7: 43,884,406 D202G probably damaging Het
March6 C T 15: 31,498,741 E137K probably benign Het
Mpp3 T C 11: 102,023,511 probably benign Het
Mroh2b T A 15: 4,931,379 Y808N probably damaging Het
Myom1 C T 17: 71,036,353 L182F probably damaging Het
Nova1 A T 12: 46,720,832 I102N unknown Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Palm G A 10: 79,807,686 G83S probably benign Het
Patl2 C T 2: 122,127,537 S80N probably benign Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Pdgfrb A T 18: 61,071,720 I551F possibly damaging Het
Pkmyt1 T A 17: 23,732,735 Y88N probably damaging Het
Pnkp T C 7: 44,858,594 S114P probably benign Het
Rdm1 T A 11: 101,630,908 V92E probably damaging Het
Sema4d T C 13: 51,703,304 R631G probably benign Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Skint9 A C 4: 112,391,865 L122R probably damaging Het
Slc16a13 T C 11: 70,217,897 N369S probably benign Het
Strada A G 11: 106,187,173 probably benign Het
Tnxb C A 17: 34,693,864 S1784Y probably damaging Het
Trpc2 T C 7: 102,087,520 V318A probably damaging Het
Ttc3 G A 16: 94,466,961 R1589H probably damaging Het
Ttyh1 A T 7: 4,130,581 D295V probably damaging Het
Unc5b A G 10: 60,783,190 Y58H probably damaging Het
Xylt1 G A 7: 117,656,461 G752D probably damaging Het
Yipf7 A T 5: 69,521,122 L55Q probably damaging Het
Zfp827 G A 8: 79,189,834 probably benign Het
Other mutations in Exoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Exoc1 APN 5 76567023 missense possibly damaging 0.88
IGL01149:Exoc1 APN 5 76542244 splice site probably benign
IGL02061:Exoc1 APN 5 76542120 missense probably damaging 0.96
IGL02288:Exoc1 APN 5 76545313 missense probably benign
IGL02407:Exoc1 APN 5 76545346 missense probably damaging 0.97
IGL03089:Exoc1 APN 5 76542158 missense possibly damaging 0.81
IGL03242:Exoc1 APN 5 76559007 missense probably damaging 1.00
IGL03348:Exoc1 APN 5 76535593 missense probably damaging 1.00
IGL03411:Exoc1 APN 5 76542195 missense probably damaging 1.00
Smalls UTSW 5 76537779 missense probably damaging 1.00
R0462:Exoc1 UTSW 5 76543617 missense probably benign 0.37
R1216:Exoc1 UTSW 5 76554188 missense probably benign
R1528:Exoc1 UTSW 5 76549564 missense possibly damaging 0.94
R1531:Exoc1 UTSW 5 76559164 missense probably damaging 0.98
R1636:Exoc1 UTSW 5 76568118 missense probably benign 0.03
R1754:Exoc1 UTSW 5 76560322 unclassified probably null
R1803:Exoc1 UTSW 5 76561441 missense probably benign 0.18
R2086:Exoc1 UTSW 5 76532846 nonsense probably null
R2239:Exoc1 UTSW 5 76559710 unclassified probably benign
R3914:Exoc1 UTSW 5 76543561 missense possibly damaging 0.54
R4022:Exoc1 UTSW 5 76549570 missense possibly damaging 0.92
R4413:Exoc1 UTSW 5 76542019 intron probably benign
R4427:Exoc1 UTSW 5 76563263 missense probably benign 0.00
R4557:Exoc1 UTSW 5 76561443 missense probably damaging 1.00
R4627:Exoc1 UTSW 5 76542228 missense probably benign 0.26
R4677:Exoc1 UTSW 5 76559163 missense probably null 0.82
R5138:Exoc1 UTSW 5 76568075 missense probably damaging 1.00
R5325:Exoc1 UTSW 5 76537702 missense probably benign
R5342:Exoc1 UTSW 5 76567014 missense probably damaging 1.00
R5736:Exoc1 UTSW 5 76537768 missense possibly damaging 0.90
R5891:Exoc1 UTSW 5 76542144 missense probably damaging 1.00
R6102:Exoc1 UTSW 5 76537779 missense probably damaging 1.00
R6447:Exoc1 UTSW 5 76543517 missense probably damaging 0.97
R6532:Exoc1 UTSW 5 76537837 missense probably damaging 0.99
R6694:Exoc1 UTSW 5 76549552 missense probably damaging 1.00
R6753:Exoc1 UTSW 5 76563339 missense probably damaging 1.00
R6885:Exoc1 UTSW 5 76559042 missense probably damaging 1.00
R7090:Exoc1 UTSW 5 76566953 missense unknown
R7299:Exoc1 UTSW 5 76542159 missense probably damaging 1.00
R7439:Exoc1 UTSW 5 76545348 missense probably benign 0.18
R7567:Exoc1 UTSW 5 76537715 missense probably damaging 0.96
R7665:Exoc1 UTSW 5 76543573 missense probably benign 0.33
R7745:Exoc1 UTSW 5 76561512 nonsense probably null
R7883:Exoc1 UTSW 5 76561382 missense probably damaging 0.99
R7966:Exoc1 UTSW 5 76561382 missense probably damaging 0.99
X0018:Exoc1 UTSW 5 76567035 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCCGAGTCTTTGACATTGC -3'
(R):5'- AGTTCTCCTCCTCACACAGGTG -3'

Sequencing Primer
(F):5'- CCCGAGTCTTTGACATTGCAAATG -3'
(R):5'- CACACAGGTGCTTGTCTACC -3'
Posted On2015-06-24