Incidental Mutation 'R4329:Fbxw22'
ID324530
Institutional Source Beutler Lab
Gene Symbol Fbxw22
Ensembl Gene ENSMUSG00000070324
Gene NameF-box and WD-40 domain protein 22
SynonymsGm5164
MMRRC Submission 041663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4329 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109378400-109404296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109384043 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 279 (T279S)
Ref Sequence ENSEMBL: ENSMUSP00000079460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080626] [ENSMUST00000197213]
Predicted Effect probably damaging
Transcript: ENSMUST00000080626
AA Change: T279S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079460
Gene: ENSMUSG00000070324
AA Change: T279S

DomainStartEndE-ValueType
FBOX 5 45 1.02e-5 SMART
SCOP:d1gxra_ 128 220 1e-5 SMART
Blast:WD40 137 176 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197213
Meta Mutation Damage Score 0.1689 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 96% (68/71)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
2900026A02Rik C A 5: 113,095,589 probably null Het
9930021J03Rik G T 19: 29,743,561 T688K probably benign Het
Adamts15 T C 9: 30,904,518 S681G probably benign Het
Ampd2 C A 3: 108,077,787 probably benign Het
Ang2 A T 14: 51,195,868 I19N possibly damaging Het
Cacna1s A C 1: 136,119,033 D1819A probably benign Het
Cand2 C A 6: 115,799,988 H1112Q possibly damaging Het
Catsperd T A 17: 56,654,517 I413K possibly damaging Het
Ccdc142 T A 6: 83,107,016 probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Celsr3 C T 9: 108,846,049 R2847C probably benign Het
Cep290 C T 10: 100,537,668 S1270L probably damaging Het
Chka T C 19: 3,875,803 probably benign Het
Cntnap5b T A 1: 100,072,163 D215E probably damaging Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Cspg4 T C 9: 56,892,465 F1539L probably damaging Het
Cwf19l2 A T 9: 3,458,878 I776F probably damaging Het
Dchs1 A T 7: 105,753,759 I3192N probably damaging Het
Dnah7c T A 1: 46,649,281 D1870E probably benign Het
Drc1 A T 5: 30,355,658 I359L probably benign Het
Esp1 A G 17: 40,728,877 M18V probably benign Het
Exoc1 T A 5: 76,567,975 F789L probably damaging Het
Frem1 G A 4: 82,986,537 A880V probably benign Het
Gm29514 A G 1: 146,420,691 noncoding transcript Het
Grm7 T C 6: 110,914,364 L186P probably damaging Het
Ipo8 A T 6: 148,800,164 probably benign Het
Klk4 A G 7: 43,884,406 D202G probably damaging Het
March6 C T 15: 31,498,741 E137K probably benign Het
Mpp3 T C 11: 102,023,511 probably benign Het
Mroh2b T A 15: 4,931,379 Y808N probably damaging Het
Myom1 C T 17: 71,036,353 L182F probably damaging Het
Nova1 A T 12: 46,720,832 I102N unknown Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Palm G A 10: 79,807,686 G83S probably benign Het
Patl2 C T 2: 122,127,537 S80N probably benign Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Pdgfrb A T 18: 61,071,720 I551F possibly damaging Het
Pkmyt1 T A 17: 23,732,735 Y88N probably damaging Het
Pnkp T C 7: 44,858,594 S114P probably benign Het
Rdm1 T A 11: 101,630,908 V92E probably damaging Het
Sema4d T C 13: 51,703,304 R631G probably benign Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Skint9 A C 4: 112,391,865 L122R probably damaging Het
Slc16a13 T C 11: 70,217,897 N369S probably benign Het
Strada A G 11: 106,187,173 probably benign Het
Tnxb C A 17: 34,693,864 S1784Y probably damaging Het
Trpc2 T C 7: 102,087,520 V318A probably damaging Het
Ttc3 G A 16: 94,466,961 R1589H probably damaging Het
Ttyh1 A T 7: 4,130,581 D295V probably damaging Het
Unc5b A G 10: 60,783,190 Y58H probably damaging Het
Xylt1 G A 7: 117,656,461 G752D probably damaging Het
Yipf7 A T 5: 69,521,122 L55Q probably damaging Het
Zfp827 G A 8: 79,189,834 probably benign Het
Other mutations in Fbxw22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Fbxw22 APN 9 109384040 missense possibly damaging 0.68
IGL00655:Fbxw22 APN 9 109382244 splice site probably benign
IGL01122:Fbxw22 APN 9 109386671 missense probably damaging 0.99
IGL01419:Fbxw22 APN 9 109381722 missense probably benign 0.03
IGL01455:Fbxw22 APN 9 109384994 missense probably benign
IGL01486:Fbxw22 APN 9 109378873 missense probably damaging 1.00
IGL01734:Fbxw22 APN 9 109383925 missense probably damaging 0.98
IGL02106:Fbxw22 APN 9 109402019 missense possibly damaging 0.86
IGL02255:Fbxw22 APN 9 109386551 splice site probably benign
IGL02466:Fbxw22 APN 9 109385092 missense probably damaging 1.00
IGL02820:Fbxw22 APN 9 109386664 missense probably damaging 1.00
R0395:Fbxw22 UTSW 9 109381685 missense probably damaging 1.00
R0705:Fbxw22 UTSW 9 109403096 missense possibly damaging 0.92
R0741:Fbxw22 UTSW 9 109382219 missense probably benign 0.01
R1603:Fbxw22 UTSW 9 109378847 missense probably benign 0.00
R1673:Fbxw22 UTSW 9 109382128 missense possibly damaging 0.93
R1874:Fbxw22 UTSW 9 109385111 nonsense probably null
R2265:Fbxw22 UTSW 9 109383994 missense probably benign 0.02
R2269:Fbxw22 UTSW 9 109383994 missense probably benign 0.02
R2385:Fbxw22 UTSW 9 109382142 missense probably damaging 1.00
R4695:Fbxw22 UTSW 9 109378871 missense probably damaging 1.00
R4731:Fbxw22 UTSW 9 109378869 missense probably benign 0.02
R4915:Fbxw22 UTSW 9 109383941 missense probably damaging 1.00
R5010:Fbxw22 UTSW 9 109403424 missense probably benign 0.40
R5070:Fbxw22 UTSW 9 109385115 missense probably benign
R5319:Fbxw22 UTSW 9 109383947 missense possibly damaging 0.52
R5571:Fbxw22 UTSW 9 109403088 missense probably damaging 1.00
R5765:Fbxw22 UTSW 9 109384996 missense probably benign 0.00
R5846:Fbxw22 UTSW 9 109386761 missense probably benign
R6002:Fbxw22 UTSW 9 109381682 nonsense probably null
R6180:Fbxw22 UTSW 9 109386679 missense probably damaging 1.00
R6313:Fbxw22 UTSW 9 109403397 missense probably damaging 0.99
R6860:Fbxw22 UTSW 9 109383962 missense probably benign 0.01
R6949:Fbxw22 UTSW 9 109382076 missense probably benign 0.06
R7084:Fbxw22 UTSW 9 109404223 missense probably damaging 1.00
R7296:Fbxw22 UTSW 9 109382075 missense probably benign
R8499:Fbxw22 UTSW 9 109385000 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCAGTTTTCCTGACTCAGAATC -3'
(R):5'- TCCTGGGTGAAGAACAGATGC -3'

Sequencing Primer
(F):5'- TTGGGACATATGACATCATGTCTG -3'
(R):5'- GTGAAGAACAGATGCAACCACTCTTG -3'
Posted On2015-06-24