Incidental Mutation 'R4329:Chka'
ID 324553
Institutional Source Beutler Lab
Gene Symbol Chka
Ensembl Gene ENSMUSG00000024843
Gene Name choline kinase alpha
Synonyms choline/ethanolamine kinase alpha, EtnK-alpha, CK/EK-alpha, Chk, ChoK
MMRRC Submission 041663-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4329 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 3851773-3894369 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 3875803 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025760] [ENSMUST00000072055] [ENSMUST00000128694] [ENSMUST00000153343]
AlphaFold O54804
Predicted Effect probably benign
Transcript: ENSMUST00000025760
SMART Domains Protein: ENSMUSP00000025760
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 373 2.4e-11 PFAM
Pfam:Choline_kinase 135 370 8.2e-82 PFAM
Pfam:EcKinase 211 345 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072055
SMART Domains Protein: ENSMUSP00000071933
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 358 6.4e-12 PFAM
Pfam:Choline_kinase 135 352 1.6e-84 PFAM
Pfam:EcKinase 190 329 2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125411
Predicted Effect probably benign
Transcript: ENSMUST00000125640
SMART Domains Protein: ENSMUSP00000119493
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
Pfam:Choline_kinase 40 230 2.2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127544
Predicted Effect probably benign
Transcript: ENSMUST00000128694
SMART Domains Protein: ENSMUSP00000119919
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
PDB:4DA5|B 1 150 2e-60 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000139655
SMART Domains Protein: ENSMUSP00000116427
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
PDB:4DA5|B 17 160 3e-68 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148325
Predicted Effect probably benign
Transcript: ENSMUST00000153343
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 96% (68/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The major pathway for the biosynthesis of phosphatidylcholine occurs via the CDP-choline pathway. The protein encoded by this gene is the initial enzyme in the sequence and may play a regulatory role. The encoded protein also catalyzes the phosphorylation of ethanolamine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality between E3.5 and E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,421,226 probably benign Het
2900026A02Rik C A 5: 113,095,589 probably null Het
9930021J03Rik G T 19: 29,743,561 T688K probably benign Het
Adamts15 T C 9: 30,904,518 S681G probably benign Het
Ampd2 C A 3: 108,077,787 probably benign Het
Ang2 A T 14: 51,195,868 I19N possibly damaging Het
Cacna1s A C 1: 136,119,033 D1819A probably benign Het
Cand2 C A 6: 115,799,988 H1112Q possibly damaging Het
Catsperd T A 17: 56,654,517 I413K possibly damaging Het
Ccdc142 T A 6: 83,107,016 probably benign Het
Cd55 A T 1: 130,452,483 C253S probably damaging Het
Celsr3 C T 9: 108,846,049 R2847C probably benign Het
Cep290 C T 10: 100,537,668 S1270L probably damaging Het
Cntnap5b T A 1: 100,072,163 D215E probably damaging Het
Col13a1 T C 10: 61,863,979 T476A unknown Het
Cspg4 T C 9: 56,892,465 F1539L probably damaging Het
Cwf19l2 A T 9: 3,458,878 I776F probably damaging Het
Dchs1 A T 7: 105,753,759 I3192N probably damaging Het
Dnah7c T A 1: 46,649,281 D1870E probably benign Het
Drc1 A T 5: 30,355,658 I359L probably benign Het
Esp1 A G 17: 40,728,877 M18V probably benign Het
Exoc1 T A 5: 76,567,975 F789L probably damaging Het
Fbxw22 T A 9: 109,384,043 T279S probably damaging Het
Frem1 G A 4: 82,986,537 A880V probably benign Het
Gm29514 A G 1: 146,420,691 noncoding transcript Het
Grm7 T C 6: 110,914,364 L186P probably damaging Het
Ipo8 A T 6: 148,800,164 probably benign Het
Klk4 A G 7: 43,884,406 D202G probably damaging Het
March6 C T 15: 31,498,741 E137K probably benign Het
Mpp3 T C 11: 102,023,511 probably benign Het
Mroh2b T A 15: 4,931,379 Y808N probably damaging Het
Myom1 C T 17: 71,036,353 L182F probably damaging Het
Nova1 A T 12: 46,720,832 I102N unknown Het
Olfr854 T A 9: 19,567,022 M121L possibly damaging Het
Pak3 T C X: 143,733,209 probably null Het
Palm G A 10: 79,807,686 G83S probably benign Het
Patl2 C T 2: 122,127,537 S80N probably benign Het
Pcdhb9 A T 18: 37,401,822 S290C probably benign Het
Pcdhb9 G T 18: 37,401,823 S290I probably benign Het
Pdgfrb A T 18: 61,071,720 I551F possibly damaging Het
Pkmyt1 T A 17: 23,732,735 Y88N probably damaging Het
Pnkp T C 7: 44,858,594 S114P probably benign Het
Rdm1 T A 11: 101,630,908 V92E probably damaging Het
Sema4d T C 13: 51,703,304 R631G probably benign Het
Sin3a T C 9: 57,095,358 L178P probably damaging Het
Skint9 A C 4: 112,391,865 L122R probably damaging Het
Slc16a13 T C 11: 70,217,897 N369S probably benign Het
Strada A G 11: 106,187,173 probably benign Het
Tnxb C A 17: 34,693,864 S1784Y probably damaging Het
Trpc2 T C 7: 102,087,520 V318A probably damaging Het
Ttc3 G A 16: 94,466,961 R1589H probably damaging Het
Ttyh1 A T 7: 4,130,581 D295V probably damaging Het
Unc5b A G 10: 60,783,190 Y58H probably damaging Het
Xylt1 G A 7: 117,656,461 G752D probably damaging Het
Yipf7 A T 5: 69,521,122 L55Q probably damaging Het
Zfp827 G A 8: 79,189,834 probably benign Het
Other mutations in Chka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Chka APN 19 3892189 missense probably benign 0.16
IGL02630:Chka APN 19 3892112 missense possibly damaging 0.94
R1432:Chka UTSW 19 3874809 splice site probably benign
R1840:Chka UTSW 19 3886460 missense probably benign 0.00
R1898:Chka UTSW 19 3892205 missense probably damaging 1.00
R3822:Chka UTSW 19 3882038 intron probably benign
R4272:Chka UTSW 19 3875737 splice site probably benign
R4573:Chka UTSW 19 3885960 missense probably damaging 1.00
R4720:Chka UTSW 19 3886375 missense probably damaging 0.99
R4923:Chka UTSW 19 3892105 critical splice acceptor site probably null
R5783:Chka UTSW 19 3864661 missense probably damaging 1.00
R5936:Chka UTSW 19 3884580 missense probably benign 0.25
R5979:Chka UTSW 19 3884513 missense probably damaging 1.00
R7429:Chka UTSW 19 3892787 missense probably damaging 1.00
R7430:Chka UTSW 19 3892787 missense probably damaging 1.00
R8189:Chka UTSW 19 3875759 nonsense probably null
R8213:Chka UTSW 19 3885882 missense probably damaging 1.00
R8397:Chka UTSW 19 3852414 critical splice donor site probably null
R8440:Chka UTSW 19 3893375 missense probably damaging 1.00
R9289:Chka UTSW 19 3885953 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGCTGGTGCCTTTAGACTATGC -3'
(R):5'- GACTCCCTACCCTAAGGAGTTAG -3'

Sequencing Primer
(F):5'- AGACTATGCTGGTCACCTGG -3'
(R):5'- CTAAGGAGTTAGGAAGCCCCTTGC -3'
Posted On 2015-06-24