Incidental Mutation 'R4330:Ramp1'
ID324557
Institutional Source Beutler Lab
Gene Symbol Ramp1
Ensembl Gene ENSMUSG00000034353
Gene Namereceptor (calcitonin) activity modifying protein 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4330 (G1)
Quality Score221
Status Not validated
Chromosome1
Chromosomal Location91179822-91225196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91223345 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 144 (T144I)
Ref Sequence ENSEMBL: ENSMUSP00000095253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097648]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097648
AA Change: T144I

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095253
Gene: ENSMUSG00000034353
AA Change: T144I

DomainStartEndE-ValueType
Pfam:RAMP 37 146 1.1e-49 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP1) protein, CRLR functions as a CGRP receptor. The RAMP1 protein is involved in the terminal glycosylation, maturation, and presentation of the CGRP receptor to the cell surface. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit high systolic blood pressure due to a disruption in vasodilatory regulation as well as significantly increased serum levels of proinflammatory cytokines following LPS administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Cnr2 T A 4: 135,916,926 I105N possibly damaging Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Eri1 G A 8: 35,469,229 R313* probably null Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hrh3 T C 2: 180,099,872 probably benign Het
Hs3st5 T A 10: 36,832,730 V87D probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Mfsd4a A C 1: 132,053,553 M320R possibly damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Rabl2 T C 15: 89,586,934 D66G probably benign Het
Rhbdf2 T C 11: 116,601,956 K413R probably benign Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Vmn1r78 T A 7: 12,152,459 probably null Het
Zfp280d C T 9: 72,295,979 T3I possibly damaging Het
Zscan25 T A 5: 145,290,551 F342I probably damaging Het
Other mutations in Ramp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01737:Ramp1 APN 1 91223099 splice site probably benign
R0049:Ramp1 UTSW 1 91196870 missense possibly damaging 0.90
R0049:Ramp1 UTSW 1 91196870 missense possibly damaging 0.90
R0256:Ramp1 UTSW 1 91196919 splice site probably benign
R1596:Ramp1 UTSW 1 91223300 missense possibly damaging 0.55
R1812:Ramp1 UTSW 1 91196857 missense probably damaging 0.99
R4331:Ramp1 UTSW 1 91223345 missense possibly damaging 0.75
R4681:Ramp1 UTSW 1 91196789 missense probably benign 0.33
R7292:Ramp1 UTSW 1 91196777 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCGGAAGTGGACAGATTCTTC -3'
(R):5'- GAGACCTGGTGCTTAGAACAATC -3'

Sequencing Primer
(F):5'- GAAGTGGACAGATTCTTCATCGC -3'
(R):5'- CCTGGTGCTTAGAACAATCTCAGAG -3'
Posted On2015-06-24