Incidental Mutation 'R4330:Mfsd4a'
ID324558
Institutional Source Beutler Lab
Gene Symbol Mfsd4a
Ensembl Gene ENSMUSG00000059149
Gene Namemajor facilitator superfamily domain containing 4A
SynonymsMfsd4, A930031D07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4330 (G1)
Quality Score223
Status Not validated
Chromosome1
Chromosomal Location132022806-132068062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 132053553 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 320 (M320R)
Ref Sequence ENSEMBL: ENSMUSP00000107984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046658] [ENSMUST00000112365] [ENSMUST00000112370] [ENSMUST00000126927] [ENSMUST00000144548] [ENSMUST00000146267] [ENSMUST00000159038] [ENSMUST00000160656] [ENSMUST00000161864]
Predicted Effect probably benign
Transcript: ENSMUST00000046658
SMART Domains Protein: ENSMUSP00000039635
Gene: ENSMUSG00000059149

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
transmembrane domain 81 99 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 218 240 N/A INTRINSIC
transmembrane domain 245 267 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 309 331 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112365
AA Change: M320R

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107984
Gene: ENSMUSG00000059149
AA Change: M320R

DomainStartEndE-ValueType
Pfam:MFS_1 21 430 1.3e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112370
AA Change: M320R

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107989
Gene: ENSMUSG00000059149
AA Change: M320R

DomainStartEndE-ValueType
Pfam:MFS_1 21 405 1.1e-11 PFAM
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126927
AA Change: M320R

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116706
Gene: ENSMUSG00000059149
AA Change: M320R

DomainStartEndE-ValueType
Pfam:MFS_1 21 405 1.1e-11 PFAM
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144548
AA Change: M320R

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116282
Gene: ENSMUSG00000059149
AA Change: M320R

DomainStartEndE-ValueType
Pfam:MFS_1 21 396 4.2e-12 PFAM
transmembrane domain 398 420 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146267
SMART Domains Protein: ENSMUSP00000117864
Gene: ENSMUSG00000059149

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159038
AA Change: M320R

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125558
Gene: ENSMUSG00000059149
AA Change: M320R

DomainStartEndE-ValueType
Pfam:MFS_1 20 395 6.8e-12 PFAM
transmembrane domain 398 420 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160656
AA Change: M214R

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125138
Gene: ENSMUSG00000059149
AA Change: M214R

DomainStartEndE-ValueType
transmembrane domain 2 20 N/A INTRINSIC
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 85 104 N/A INTRINSIC
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
transmembrane domain 292 314 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
transmembrane domain 354 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161864
AA Change: M236R

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124961
Gene: ENSMUSG00000059149
AA Change: M236R

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
Pfam:MFS_1 218 420 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181695
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Cnr2 T A 4: 135,916,926 I105N possibly damaging Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Eri1 G A 8: 35,469,229 R313* probably null Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hrh3 T C 2: 180,099,872 probably benign Het
Hs3st5 T A 10: 36,832,730 V87D probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Rabl2 T C 15: 89,586,934 D66G probably benign Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 T C 11: 116,601,956 K413R probably benign Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Vmn1r78 T A 7: 12,152,459 probably null Het
Zfp280d C T 9: 72,295,979 T3I possibly damaging Het
Zscan25 T A 5: 145,290,551 F342I probably damaging Het
Other mutations in Mfsd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Mfsd4a APN 1 132040594 missense probably benign 0.34
IGL01348:Mfsd4a APN 1 132067826 missense probably null 0.96
IGL01621:Mfsd4a APN 1 132054143 missense probably benign 0.16
IGL01934:Mfsd4a APN 1 132046311 missense probably damaging 1.00
IGL02429:Mfsd4a APN 1 132028499 missense probably benign
R0362:Mfsd4a UTSW 1 132059275 missense probably damaging 1.00
R0551:Mfsd4a UTSW 1 132041919 missense probably damaging 1.00
R1435:Mfsd4a UTSW 1 132067756 missense probably damaging 1.00
R1566:Mfsd4a UTSW 1 132059179 missense probably damaging 1.00
R1739:Mfsd4a UTSW 1 132067883 missense possibly damaging 0.85
R1793:Mfsd4a UTSW 1 132059339 missense probably damaging 0.98
R1799:Mfsd4a UTSW 1 132053596 missense possibly damaging 0.63
R2244:Mfsd4a UTSW 1 132028505 missense probably benign 0.09
R3870:Mfsd4a UTSW 1 132046353 missense probably damaging 0.99
R4177:Mfsd4a UTSW 1 132040557 missense probably damaging 0.99
R4705:Mfsd4a UTSW 1 132053571 missense probably damaging 1.00
R4717:Mfsd4a UTSW 1 132057895 missense probably benign 0.00
R5886:Mfsd4a UTSW 1 132067727 missense probably damaging 0.96
R5890:Mfsd4a UTSW 1 132038928 missense probably damaging 1.00
R7092:Mfsd4a UTSW 1 132067663 missense probably benign 0.06
R7189:Mfsd4a UTSW 1 132052393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTCACGTAGAATTGGGAAC -3'
(R):5'- TGCCTGGAAGCTAGAGGAATTG -3'

Sequencing Primer
(F):5'- AGTCCTGACTCTAGGGCTG -3'
(R):5'- TGTCCGGCCTGGGTGAAC -3'
Posted On2015-06-24