Incidental Mutation 'R4330:Hrh3'
ID324559
Institutional Source Beutler Lab
Gene Symbol Hrh3
Ensembl Gene ENSMUSG00000039059
Gene Namehistamine receptor H3
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R4330 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location180099465-180104488 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 180099872 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056480] [ENSMUST00000163215] [ENSMUST00000164442] [ENSMUST00000165248] [ENSMUST00000165762] [ENSMUST00000166724] [ENSMUST00000171736]
Predicted Effect probably benign
Transcript: ENSMUST00000056480
SMART Domains Protein: ENSMUSP00000049963
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 7.2e-65 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000163215
AA Change: M394V
SMART Domains Protein: ENSMUSP00000127053
Gene: ENSMUSG00000039059
AA Change: M394V

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 376 2e-55 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164442
SMART Domains Protein: ENSMUSP00000130553
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 380 4.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165248
SMART Domains Protein: ENSMUSP00000130181
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 364 6.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165762
SMART Domains Protein: ENSMUSP00000132203
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 1.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166392
Predicted Effect probably benign
Transcript: ENSMUST00000166724
SMART Domains Protein: ENSMUSP00000126336
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 93 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171736
SMART Domains Protein: ENSMUSP00000127085
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 239 5.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172211
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. This gene encodes one of the histamine receptors (H3) which belongs to the family 1 of G protein-coupled receptors. It is an integral membrane protein and can regulate neurotransmitter release. This receptor can also increase voltage-dependent calcium current in smooth muscles and innervates the blood vessels and the heart in cardiovascular system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced locomotor activity and body temperature, and attenuated behavioral responses to the drugs thioperamide, methamphetamine, and scopolamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Cnr2 T A 4: 135,916,926 I105N possibly damaging Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Eri1 G A 8: 35,469,229 R313* probably null Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hs3st5 T A 10: 36,832,730 V87D probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Mfsd4a A C 1: 132,053,553 M320R possibly damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Rabl2 T C 15: 89,586,934 D66G probably benign Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 T C 11: 116,601,956 K413R probably benign Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Vmn1r78 T A 7: 12,152,459 probably null Het
Zfp280d C T 9: 72,295,979 T3I possibly damaging Het
Zscan25 T A 5: 145,290,551 F342I probably damaging Het
Other mutations in Hrh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Hrh3 APN 2 180101103 missense possibly damaging 0.69
IGL01827:Hrh3 APN 2 180103946 missense possibly damaging 0.95
IGL01912:Hrh3 APN 2 180101376 missense probably damaging 1.00
IGL02992:Hrh3 APN 2 180100815 missense probably benign 0.11
IGL03273:Hrh3 APN 2 180100648 missense possibly damaging 0.85
R1403:Hrh3 UTSW 2 180102754 missense probably damaging 1.00
R1403:Hrh3 UTSW 2 180102754 missense probably damaging 1.00
R1808:Hrh3 UTSW 2 180099784 unclassified probably benign
R2060:Hrh3 UTSW 2 180101250 missense possibly damaging 0.95
R4110:Hrh3 UTSW 2 180102850 missense possibly damaging 0.84
R4111:Hrh3 UTSW 2 180102850 missense possibly damaging 0.84
R4113:Hrh3 UTSW 2 180102850 missense possibly damaging 0.84
R4935:Hrh3 UTSW 2 180101268 missense probably damaging 1.00
R5050:Hrh3 UTSW 2 180100557 missense probably damaging 1.00
R5543:Hrh3 UTSW 2 180103970 missense probably damaging 0.99
R5780:Hrh3 UTSW 2 180100815 missense probably damaging 0.96
R7571:Hrh3 UTSW 2 180101286 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATTCTGACTGCGCAGATGGG -3'
(R):5'- TCTCTCCCAAGACGATCTGG -3'

Sequencing Primer
(F):5'- CGCAGATGGGGCAAGCAG -3'
(R):5'- AGACGATCTGGGGCGATGC -3'
Posted On2015-06-24