Incidental Mutation 'R4330:Cnr2'
ID324561
Institutional Source Beutler Lab
Gene Symbol Cnr2
Ensembl Gene ENSMUSG00000062585
Gene Namecannabinoid receptor 2 (macrophage)
Synonymscannabinoid receptor 2 (spleen), CB2, CB2-R
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4330 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location135895394-135920207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135916926 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 105 (I105N)
Ref Sequence ENSEMBL: ENSMUSP00000095454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030434] [ENSMUST00000068830] [ENSMUST00000097843]
Predicted Effect probably benign
Transcript: ENSMUST00000030434
SMART Domains Protein: ENSMUSP00000030434
Gene: ENSMUSG00000028673

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Alpha_L_fucos 22 399 7.97e-234 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000068830
AA Change: I105N

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069957
Gene: ENSMUSG00000062585
AA Change: I105N

DomainStartEndE-ValueType
Pfam:7tm_1 50 299 1.8e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097843
AA Change: I105N

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095454
Gene: ENSMUSG00000062585
AA Change: I105N

DomainStartEndE-ValueType
Pfam:7tm_1 50 299 8e-37 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cannabinoid delta-9-tetrahydrocannabinol is the principal psychoactive ingredient of marijuana. The proteins encoded by this gene and the cannabinoid receptor 1 (brain) (CNR1) gene have the characteristics of a guanine nucleotide-binding protein (G-protein)-coupled receptor for cannabinoids. They inhibit adenylate cyclase activity in a dose-dependent, stereoselective, and pertussis toxin-sensitive manner. These proteins have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. The cannabinoid receptors are members of family 1 of the G-protein-coupled receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Macrophages from homozygous mutant animals are resistant to the inhibitory effects of delta9-Tetrahydrocannabinol. Alopecia is seen in some but not all homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Eri1 G A 8: 35,469,229 R313* probably null Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hrh3 T C 2: 180,099,872 probably benign Het
Hs3st5 T A 10: 36,832,730 V87D probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Mfsd4a A C 1: 132,053,553 M320R possibly damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Rabl2 T C 15: 89,586,934 D66G probably benign Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 T C 11: 116,601,956 K413R probably benign Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Vmn1r78 T A 7: 12,152,459 probably null Het
Zfp280d C T 9: 72,295,979 T3I possibly damaging Het
Zscan25 T A 5: 145,290,551 F342I probably damaging Het
Other mutations in Cnr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Cnr2 APN 4 135916805 missense probably damaging 1.00
IGL02233:Cnr2 APN 4 135917211 missense possibly damaging 0.76
IGL02887:Cnr2 APN 4 135917625 missense possibly damaging 0.90
PIT4791001:Cnr2 UTSW 4 135916952 missense probably damaging 1.00
R0480:Cnr2 UTSW 4 135917601 missense probably benign 0.00
R0616:Cnr2 UTSW 4 135917562 missense probably benign 0.39
R0945:Cnr2 UTSW 4 135917321 missense probably benign 0.16
R1242:Cnr2 UTSW 4 135916983 missense probably damaging 1.00
R1538:Cnr2 UTSW 4 135916701 missense probably benign 0.00
R4911:Cnr2 UTSW 4 135917201 missense possibly damaging 0.88
R4960:Cnr2 UTSW 4 135917607 missense probably benign 0.01
R5289:Cnr2 UTSW 4 135917007 missense probably damaging 1.00
R5642:Cnr2 UTSW 4 135916765 missense probably damaging 1.00
R5681:Cnr2 UTSW 4 135916689 missense probably damaging 0.99
R5807:Cnr2 UTSW 4 135917436 missense probably benign 0.00
R6843:Cnr2 UTSW 4 135917589 missense probably benign
R8024:Cnr2 UTSW 4 135916885 missense probably damaging 1.00
R8423:Cnr2 UTSW 4 135917516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGATCCTGAGCAGTGGC -3'
(R):5'- ATGCTGAGAGGACCCACATG -3'

Sequencing Primer
(F):5'- TGCTGTGCACCCTGATG -3'
(R):5'- TGACACAGAGGGCCACCAG -3'
Posted On2015-06-24