Incidental Mutation 'R4330:Zscan25'
ID324562
Institutional Source Beutler Lab
Gene Symbol Zscan25
Ensembl Gene ENSMUSG00000070420
Gene Namezinc finger and SCAN domain containing 25
SynonymsZfp498, EG666311
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R4330 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145280500-145291278 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145290551 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 342 (F342I)
Ref Sequence ENSEMBL: ENSMUSP00000091664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094116] [ENSMUST00000199563] [ENSMUST00000200246]
Predicted Effect probably damaging
Transcript: ENSMUST00000094116
AA Change: F342I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091664
Gene: ENSMUSG00000070420
AA Change: F342I

DomainStartEndE-ValueType
SCAN 38 150 5.94e-53 SMART
Blast:KRAB 231 288 4e-31 BLAST
ZnF_C2H2 346 368 2.15e-5 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 402 424 8.34e-3 SMART
ZnF_C2H2 430 452 3.39e-3 SMART
ZnF_C2H2 458 479 1.08e1 SMART
ZnF_C2H2 485 507 4.47e-3 SMART
ZnF_C2H2 513 536 5.59e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197174
Predicted Effect probably benign
Transcript: ENSMUST00000199563
SMART Domains Protein: ENSMUSP00000143449
Gene: ENSMUSG00000070420

DomainStartEndE-ValueType
SCAN 38 150 2.1e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200246
SMART Domains Protein: ENSMUSP00000142367
Gene: ENSMUSG00000070420

DomainStartEndE-ValueType
SCAN 38 150 1.9e-55 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that bears some similarity to zinc finger proteins, which are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants have been identified, but the full-length nature for most of them has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Cnr2 T A 4: 135,916,926 I105N possibly damaging Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Eri1 G A 8: 35,469,229 R313* probably null Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hrh3 T C 2: 180,099,872 probably benign Het
Hs3st5 T A 10: 36,832,730 V87D probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Mfsd4a A C 1: 132,053,553 M320R possibly damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Rabl2 T C 15: 89,586,934 D66G probably benign Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 T C 11: 116,601,956 K413R probably benign Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Vmn1r78 T A 7: 12,152,459 probably null Het
Zfp280d C T 9: 72,295,979 T3I possibly damaging Het
Other mutations in Zscan25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Zscan25 APN 5 145283749 missense probably damaging 1.00
IGL02622:Zscan25 APN 5 145290702 missense probably damaging 1.00
IGL02881:Zscan25 APN 5 145290486 missense probably benign 0.25
PIT4445001:Zscan25 UTSW 5 145290612 missense probably damaging 1.00
R1713:Zscan25 UTSW 5 145283691 missense probably damaging 0.99
R1828:Zscan25 UTSW 5 145291048 missense possibly damaging 0.95
R2233:Zscan25 UTSW 5 145283692 missense probably damaging 1.00
R3882:Zscan25 UTSW 5 145291052 missense probably damaging 1.00
R4527:Zscan25 UTSW 5 145283458 missense probably damaging 1.00
R4539:Zscan25 UTSW 5 145288391 missense probably benign 0.01
R4598:Zscan25 UTSW 5 145291005 missense probably benign 0.30
R4611:Zscan25 UTSW 5 145291116 missense probably damaging 1.00
R4662:Zscan25 UTSW 5 145286310 missense unknown
R6733:Zscan25 UTSW 5 145290913 splice site probably null
R6751:Zscan25 UTSW 5 145290563 missense probably damaging 1.00
R7161:Zscan25 UTSW 5 145286441 missense probably benign 0.00
R7912:Zscan25 UTSW 5 145290511 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTTTGTCACACAGGTGC -3'
(R):5'- ACACACATAGGGCCTCTTGC -3'

Sequencing Primer
(F):5'- TGTCACACAGGTGCTGGGAG -3'
(R):5'- GCCTCTTGCCCAGGTGG -3'
Posted On2015-06-24