Incidental Mutation 'R4330:Eri1'
ID324566
Institutional Source Beutler Lab
Gene Symbol Eri1
Ensembl Gene ENSMUSG00000031527
Gene Nameexoribonuclease 1
SynonymsEri1, Thex1, 3110010F15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4330 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location35465253-35496196 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 35469229 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 313 (R313*)
Ref Sequence ENSEMBL: ENSMUSP00000033927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033927]
Predicted Effect probably null
Transcript: ENSMUST00000033927
AA Change: R313*
SMART Domains Protein: ENSMUSP00000033927
Gene: ENSMUSG00000031527
AA Change: R313*

DomainStartEndE-ValueType
SAP 72 106 1.24e-5 SMART
EXOIII 125 311 4.63e-23 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, decreased body size beginning at E15.5, and decreased proliferation of mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Cnr2 T A 4: 135,916,926 I105N possibly damaging Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hrh3 T C 2: 180,099,872 probably benign Het
Hs3st5 T A 10: 36,832,730 V87D probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Mfsd4a A C 1: 132,053,553 M320R possibly damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Rabl2 T C 15: 89,586,934 D66G probably benign Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 T C 11: 116,601,956 K413R probably benign Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Vmn1r78 T A 7: 12,152,459 probably null Het
Zfp280d C T 9: 72,295,979 T3I possibly damaging Het
Zscan25 T A 5: 145,290,551 F342I probably damaging Het
Other mutations in Eri1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Eri1 APN 8 35482682 missense possibly damaging 0.53
IGL00990:Eri1 APN 8 35482646 missense probably benign
IGL01732:Eri1 APN 8 35491243 missense possibly damaging 0.85
R1467:Eri1 UTSW 8 35469130 makesense probably null
R1467:Eri1 UTSW 8 35469130 makesense probably null
R1496:Eri1 UTSW 8 35469181 missense possibly damaging 0.92
R2431:Eri1 UTSW 8 35476478 missense probably damaging 1.00
R3862:Eri1 UTSW 8 35491294 missense possibly damaging 0.85
R4831:Eri1 UTSW 8 35476519 missense possibly damaging 0.92
R5524:Eri1 UTSW 8 35478609 missense probably benign 0.00
R6594:Eri1 UTSW 8 35482533 missense probably damaging 1.00
R7043:Eri1 UTSW 8 35478638 missense probably damaging 0.99
R7101:Eri1 UTSW 8 35482623 missense probably damaging 0.98
R7626:Eri1 UTSW 8 35474400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCATACATACCCATCTATCTGTAAT -3'
(R):5'- CGAGTTCTTAATTACTTACTTGGTTCT -3'

Sequencing Primer
(F):5'- CTTAAATGTTTAAGGTGCTTGAAGG -3'
(R):5'- TTTGTTTTCTAGGTTCCCAGAAGC -3'
Posted On2015-06-24