Incidental Mutation 'R4330:Zfp280d'
ID324568
Institutional Source Beutler Lab
Gene Symbol Zfp280d
Ensembl Gene ENSMUSG00000038535
Gene Namezinc finger protein 280D
SynonymsSuhw4
Accession Numbers

Ncbi RefSeq: NM_146224.4; MGI:2384583

Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R4330 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location72274860-72363777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72295979 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 3 (T3I)
Ref Sequence ENSEMBL: ENSMUSP00000138902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098576] [ENSMUST00000183410] [ENSMUST00000183801] [ENSMUST00000184036] [ENSMUST00000184053] [ENSMUST00000184399] [ENSMUST00000184517]
Predicted Effect probably benign
Transcript: ENSMUST00000098576
AA Change: T3I

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096175
Gene: ENSMUSG00000038535
AA Change: T3I

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 241 6.8e-82 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183400
Predicted Effect probably benign
Transcript: ENSMUST00000183410
AA Change: T3I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139250
Gene: ENSMUSG00000038535
AA Change: T3I

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 4.1e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183801
AA Change: T3I

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139091
Gene: ENSMUSG00000038535
AA Change: T3I

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 1.9e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184036
SMART Domains Protein: ENSMUSP00000138857
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:DUF4195 32 217 5.5e-98 PFAM
ZnF_C2H2 227 247 1.24e2 SMART
ZnF_C2H2 308 330 6.92e0 SMART
ZnF_C2H2 345 368 3.99e0 SMART
ZnF_C2H2 375 398 1.08e-1 SMART
ZnF_C2H2 405 428 3.52e-1 SMART
ZnF_C2H2 434 456 2.41e1 SMART
ZnF_C2H2 462 484 3.38e1 SMART
low complexity region 514 536 N/A INTRINSIC
low complexity region 566 586 N/A INTRINSIC
ZnF_C2H2 631 654 1.23e1 SMART
ZnF_C2H2 677 701 1.34e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184053
AA Change: T3I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138848
Gene: ENSMUSG00000038535
AA Change: T3I

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 147 1e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184399
AA Change: T3I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138902
Gene: ENSMUSG00000038535
AA Change: T3I

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 103 4.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184517
AA Change: T3I

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138970
Gene: ENSMUSG00000038535
AA Change: T3I

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 2.2e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184786
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(100) : Targeted(2) Gene trapped(98)

Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Cnr2 T A 4: 135,916,926 I105N possibly damaging Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Eri1 G A 8: 35,469,229 R313* probably null Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hrh3 T C 2: 180,099,872 probably benign Het
Hs3st5 T A 10: 36,832,730 V87D probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Mfsd4a A C 1: 132,053,553 M320R possibly damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Rabl2 T C 15: 89,586,934 D66G probably benign Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 T C 11: 116,601,956 K413R probably benign Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Vmn1r78 T A 7: 12,152,459 probably null Het
Zscan25 T A 5: 145,290,551 F342I probably damaging Het
Other mutations in Zfp280d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Zfp280d APN 9 72322571 missense probably damaging 1.00
IGL00708:Zfp280d APN 9 72312135 missense probably benign 0.19
IGL01333:Zfp280d APN 9 72335114 splice site probably benign
IGL01453:Zfp280d APN 9 72322586 missense possibly damaging 0.90
IGL02472:Zfp280d APN 9 72301711 missense probably damaging 1.00
IGL02583:Zfp280d APN 9 72322445 splice site probably benign
IGL02608:Zfp280d APN 9 72307979 missense probably damaging 0.98
IGL02675:Zfp280d APN 9 72312222 missense probably benign 0.33
IGL02676:Zfp280d APN 9 72335074 missense probably damaging 1.00
IGL02931:Zfp280d APN 9 72296025 missense probably benign 0.02
IGL03076:Zfp280d APN 9 72312662 missense probably damaging 0.99
R0017:Zfp280d UTSW 9 72339010 critical splice acceptor site probably null
R0017:Zfp280d UTSW 9 72339010 critical splice acceptor site probably null
R0288:Zfp280d UTSW 9 72331339 nonsense probably null
R0419:Zfp280d UTSW 9 72312237 missense probably benign 0.02
R0540:Zfp280d UTSW 9 72307965 missense probably damaging 0.97
R0628:Zfp280d UTSW 9 72361948 missense probably benign
R0722:Zfp280d UTSW 9 72312101 missense possibly damaging 0.63
R1055:Zfp280d UTSW 9 72329167 splice site probably null
R1786:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R1826:Zfp280d UTSW 9 72298780 missense probably damaging 1.00
R1962:Zfp280d UTSW 9 72335080 nonsense probably null
R2130:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2132:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2133:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2143:Zfp280d UTSW 9 72312729 missense probably damaging 1.00
R2162:Zfp280d UTSW 9 72298822 missense probably damaging 1.00
R2266:Zfp280d UTSW 9 72301770 splice site probably benign
R2269:Zfp280d UTSW 9 72301770 splice site probably benign
R2278:Zfp280d UTSW 9 72338773 nonsense probably null
R2850:Zfp280d UTSW 9 72312089 missense probably benign 0.06
R3780:Zfp280d UTSW 9 72322524 missense probably damaging 1.00
R3950:Zfp280d UTSW 9 72296019 missense possibly damaging 0.49
R4716:Zfp280d UTSW 9 72312665 missense possibly damaging 0.94
R4876:Zfp280d UTSW 9 72298858 splice site probably benign
R4909:Zfp280d UTSW 9 72331432 missense probably damaging 1.00
R5214:Zfp280d UTSW 9 72308113 unclassified probably benign
R5518:Zfp280d UTSW 9 72324135 missense probably damaging 0.99
R5853:Zfp280d UTSW 9 72330942 missense probably benign 0.20
R5945:Zfp280d UTSW 9 72362332 nonsense probably null
R6033:Zfp280d UTSW 9 72329137 missense probably damaging 1.00
R6033:Zfp280d UTSW 9 72329137 missense probably damaging 1.00
R7043:Zfp280d UTSW 9 72319257 missense probably damaging 1.00
R7501:Zfp280d UTSW 9 72361942 missense possibly damaging 0.65
R7658:Zfp280d UTSW 9 72324072 missense probably damaging 1.00
R7667:Zfp280d UTSW 9 72301965 missense probably damaging 1.00
R7792:Zfp280d UTSW 9 72331319 missense probably damaging 1.00
R7826:Zfp280d UTSW 9 72312671 missense possibly damaging 0.68
R7964:Zfp280d UTSW 9 72322458 missense probably damaging 1.00
R8096:Zfp280d UTSW 9 72319278 missense probably damaging 1.00
R8188:Zfp280d UTSW 9 72360333 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTGTGTGAGTGCAGGCAC -3'
(R):5'- CTGACATAAACAGTAGCTATTTCTGTT -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTGAGCCACC -3'
(R):5'- GTTCTAAGATGGGGACCATC -3'
Posted On2015-06-24